ID: 1011399147

View in Genome Browser
Species Human (GRCh38)
Location 6:86940736-86940758
Sequence CAAATCTAACGCTCTAATGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 82}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011399140_1011399147 24 Left 1011399140 6:86940689-86940711 CCCACCCTGGAATTCTATTTCTG 0: 1
1: 0
2: 1
3: 22
4: 319
Right 1011399147 6:86940736-86940758 CAAATCTAACGCTCTAATGTGGG 0: 1
1: 0
2: 0
3: 4
4: 82
1011399142_1011399147 20 Left 1011399142 6:86940693-86940715 CCCTGGAATTCTATTTCTGCACT 0: 1
1: 0
2: 1
3: 23
4: 256
Right 1011399147 6:86940736-86940758 CAAATCTAACGCTCTAATGTGGG 0: 1
1: 0
2: 0
3: 4
4: 82
1011399141_1011399147 23 Left 1011399141 6:86940690-86940712 CCACCCTGGAATTCTATTTCTGC 0: 1
1: 0
2: 2
3: 20
4: 267
Right 1011399147 6:86940736-86940758 CAAATCTAACGCTCTAATGTGGG 0: 1
1: 0
2: 0
3: 4
4: 82
1011399143_1011399147 19 Left 1011399143 6:86940694-86940716 CCTGGAATTCTATTTCTGCACTA 0: 1
1: 0
2: 1
3: 18
4: 232
Right 1011399147 6:86940736-86940758 CAAATCTAACGCTCTAATGTGGG 0: 1
1: 0
2: 0
3: 4
4: 82
1011399144_1011399147 -4 Left 1011399144 6:86940717-86940739 CCCTTTAAAAGTGAAAGATCAAA 0: 1
1: 0
2: 2
3: 59
4: 634
Right 1011399147 6:86940736-86940758 CAAATCTAACGCTCTAATGTGGG 0: 1
1: 0
2: 0
3: 4
4: 82
1011399145_1011399147 -5 Left 1011399145 6:86940718-86940740 CCTTTAAAAGTGAAAGATCAAAT 0: 1
1: 0
2: 3
3: 52
4: 589
Right 1011399147 6:86940736-86940758 CAAATCTAACGCTCTAATGTGGG 0: 1
1: 0
2: 0
3: 4
4: 82

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011399147 Original CRISPR CAAATCTAACGCTCTAATGT GGG Intronic
900953103 1:5870093-5870115 TACATCTAACGCTCAAATCTTGG + Intronic
903039446 1:20517671-20517693 CTAATCTAATGCTCCAAAGTGGG - Intergenic
904339017 1:29821072-29821094 CAAATCTATCTCTCTGGTGTGGG - Intergenic
905813186 1:40928123-40928145 CAAATGTACCCCTCTAATGGAGG + Intergenic
908962820 1:69721173-69721195 CAAATATAACACTCTTGTGTGGG - Intronic
909755811 1:79223701-79223723 CAAATGTACCTTTCTAATGTAGG + Intergenic
911712735 1:101094281-101094303 TAAATCTAACACTCTGATGAGGG - Intergenic
912257247 1:108072855-108072877 CAAATCTGTCTCTCTAATCTGGG - Intergenic
913092691 1:115490283-115490305 CAAATGTACCACTCTGATGTGGG + Intergenic
914838375 1:151227152-151227174 CAAATATACAGCTATAATGTTGG - Intronic
915941134 1:160119077-160119099 CAAATGTAACACTCTGATGCAGG + Intronic
917585139 1:176418220-176418242 CAAATGTACCACTCTAATGGAGG - Intergenic
920948212 1:210549174-210549196 CACATGTAAAGCTCTAAGGTAGG + Intronic
924361664 1:243247811-243247833 CAAATCTAACACTATCAAGTTGG + Intronic
924643302 1:245854103-245854125 CAAATCTTACCCTATAATGTGGG + Intronic
1065203483 10:23336469-23336491 CACATCTAACACTCAGATGTTGG + Intronic
1065504136 10:26412183-26412205 ACAATGTAACACTCTAATGTAGG + Intergenic
1081511029 11:43773657-43773679 CTAATCTAACACTCTGATGTGGG - Intronic
1087580299 11:100042196-100042218 CAAAACTAAACCACTAATGTGGG - Intronic
1091503416 12:1041542-1041564 CAAATCTAAAGGCCTTATGTGGG + Intronic
1093906028 12:24692811-24692833 CACATCTAAAGCTCTAAAGCAGG - Intergenic
1101571253 12:105955725-105955747 CAAAACTTACGCTCTTATCTCGG - Intergenic
1105643739 13:22294145-22294167 CAAATGTACCACTCTAATGGTGG - Intergenic
1107189750 13:37566647-37566669 CAAATCTTAACCTCTTATGTTGG + Intronic
1118511777 14:66483048-66483070 AAAGTCAAATGCTCTAATGTTGG + Intergenic
1121989443 14:98541571-98541593 CAAATCTAACGTTGTATTGAGGG - Intergenic
1127163115 15:56212545-56212567 CAACTGTACCACTCTAATGTAGG + Intronic
1130837560 15:87665654-87665676 ATAATCTAATGCTCTAAAGTAGG - Intergenic
1138935802 16:61720758-61720780 CAAATCTATTGCTCTAATATTGG - Intronic
1139331187 16:66191971-66191993 AAAAACTAACGCTCTATTGCAGG + Intergenic
1146048638 17:29531807-29531829 CAAAACTAAGGCTATTATGTGGG + Intronic
1148761397 17:50003545-50003567 CAAATGTATCACACTAATGTAGG + Intergenic
1149212859 17:54323958-54323980 AAAATCTAATGCTCCAAAGTAGG + Intergenic
1151204851 17:72498954-72498976 CAAGCCTAAGGCTCTGATGTTGG - Intergenic
1155630199 18:27884105-27884127 CAAATATACCACTCTAGTGTGGG + Intergenic
1155678142 18:28455823-28455845 AAAATCTAAAGCTTTAATATTGG + Intergenic
1156908669 18:42384980-42385002 CAAACCTAACACTCAAATATAGG + Intergenic
1159373102 18:67554916-67554938 CAAATATACCACTCTGATGTGGG - Intergenic
941660292 2:168189807-168189829 CAAAGCTAAAACTCTATTGTAGG + Intronic
943930777 2:193850060-193850082 CAAATCTAACACTTTAGTCTTGG - Intergenic
944362963 2:198880178-198880200 CAAAGCATTCGCTCTAATGTTGG + Intergenic
944461268 2:199953375-199953397 CAAATATACCACTCTAATGAGGG + Intronic
1171384518 20:24761137-24761159 CAAATGTATCACTCTAGTGTGGG + Intergenic
1179085898 21:38217453-38217475 CAAATCTAACCCACTGATCTGGG - Intronic
1182915537 22:34026018-34026040 CAAATGTAAATCTCCAATGTTGG + Intergenic
951477118 3:23118572-23118594 CAAATCTATCACTTTAATTTTGG - Intergenic
954067842 3:48121014-48121036 CAACTCTACCGTTGTAATGTCGG + Intergenic
957005423 3:74940209-74940231 CAAATGTACCACTCTGATGTGGG + Intergenic
958266694 3:91446097-91446119 CAAATCTAAAACTCCAATTTAGG + Intergenic
960301069 3:116003215-116003237 CATATCTAAAGCTCAAATGTAGG + Intronic
963582515 3:147144087-147144109 TAAATCAAACTCTCTAATTTTGG + Intergenic
964073129 3:152659415-152659437 CAAATCTTACTTTCTAATTTTGG + Intergenic
965181689 3:165412147-165412169 CAAATGTACCACTCTGATGTGGG + Intergenic
970395666 4:15663020-15663042 CAAATGTAACTTTCTAATTTGGG + Intronic
974394020 4:61311931-61311953 CAAATGTACCACTCTCATGTGGG + Intronic
974638930 4:64604469-64604491 CAAATCTGGGGCTCCAATGTTGG + Intergenic
976064154 4:81164620-81164642 CACACCTAACACTCTAATGGTGG - Intronic
980423374 4:132593131-132593153 CAATTCTAGTTCTCTAATGTAGG + Intergenic
984027723 4:174564554-174564576 CAAATGTATCACTCTAGTGTAGG - Intergenic
986678862 5:10215474-10215496 CAAATCTAACACTTTACTATGGG - Intergenic
987514181 5:18884529-18884551 CAAATGTAACACTTTGATGTGGG + Intergenic
993604396 5:89970419-89970441 TAAATTTAACACTCTAATTTAGG - Intergenic
994070735 5:95599072-95599094 CAGAGCTAACATTCTAATGTGGG - Intronic
995163475 5:109009472-109009494 TAAATTTAACTCTCAAATGTTGG + Intronic
1009177126 6:60474087-60474109 CAAATCTAAAACTCCAATCTAGG - Intergenic
1011057277 6:83218633-83218655 CAAATCTGGCCCTCTGATGTAGG - Intronic
1011399147 6:86940736-86940758 CAAATCTAACGCTCTAATGTGGG + Intronic
1020353305 7:7248239-7248261 CAACTCTAAAACTTTAATGTTGG - Exonic
1020467035 7:8492178-8492200 AAAATCTAAAATTCTAATGTCGG - Intronic
1026286160 7:68964798-68964820 AAAAAATAACCCTCTAATGTAGG + Intergenic
1028973800 7:96889880-96889902 CAAATCTTTGGCTCTAATTTTGG - Intergenic
1032092745 7:128919525-128919547 CAAATCTACCTCTCTCATTTTGG - Intergenic
1034499759 7:151441987-151442009 CAAATGTACCACTCTAATGGGGG - Intergenic
1036628787 8:10495997-10496019 CAAATCTCACAGTCTAATGAAGG - Intergenic
1039804048 8:40983665-40983687 GAAATCTAACACTGTAAAGTTGG + Intergenic
1042208877 8:66357566-66357588 CAAATATACCACTCTAGTGTGGG - Intergenic
1043963347 8:86443815-86443837 CAAGACAAAGGCTCTAATGTGGG + Intronic
1046260812 8:111765606-111765628 CAAATATAACATTCTAATGCTGG + Intergenic
1048994211 8:139781664-139781686 CAAATGTACCACTCTAGTGTGGG + Intronic
1052892756 9:33719531-33719553 CACACCTAACGCTCTACTGCTGG - Intergenic
1056728075 9:89139879-89139901 AGAATCTAATGCTCTAAAGTAGG + Intronic
1056995040 9:91448296-91448318 CAAATGTAACTGTTTAATGTTGG - Intergenic
1189086392 X:38029583-38029605 AGAATCTAATGCTCTAAAGTAGG + Intronic
1191831180 X:65418277-65418299 CAATTCCAATGCTCTAATGGAGG + Intronic
1193934217 X:87595904-87595926 CAAATTTAATTCTCCAATGTTGG + Intronic
1194240823 X:91445122-91445144 CACCTCTAATCCTCTAATGTAGG + Intergenic
1201625182 Y:16006929-16006951 CAAATCTGTCTCTCTAATATGGG - Intergenic