ID: 1011399480

View in Genome Browser
Species Human (GRCh38)
Location 6:86944261-86944283
Sequence TAGTTTCAGCCTAATTCAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 109}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011399477_1011399480 -3 Left 1011399477 6:86944241-86944263 CCTCATTAGAGACAAGTCACTAG 0: 1
1: 0
2: 1
3: 7
4: 77
Right 1011399480 6:86944261-86944283 TAGTTTCAGCCTAATTCAAGGGG 0: 1
1: 0
2: 0
3: 13
4: 109
1011399475_1011399480 17 Left 1011399475 6:86944221-86944243 CCCATGGCTTCTGCTGTGTTCCT 0: 1
1: 0
2: 6
3: 24
4: 324
Right 1011399480 6:86944261-86944283 TAGTTTCAGCCTAATTCAAGGGG 0: 1
1: 0
2: 0
3: 13
4: 109
1011399476_1011399480 16 Left 1011399476 6:86944222-86944244 CCATGGCTTCTGCTGTGTTCCTC 0: 1
1: 0
2: 6
3: 53
4: 461
Right 1011399480 6:86944261-86944283 TAGTTTCAGCCTAATTCAAGGGG 0: 1
1: 0
2: 0
3: 13
4: 109

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011399480 Original CRISPR TAGTTTCAGCCTAATTCAAG GGG Intronic
900273965 1:1811205-1811227 TAGTTTCAGCTGCACTCAAGAGG - Intronic
906664035 1:47605170-47605192 TATTTAAAGCTTAATTCAAGAGG + Intergenic
906847705 1:49211844-49211866 TAGTTTAAACCTACTTCAAATGG - Intronic
910935307 1:92481874-92481896 TAGTTTTAGCAAAATTCACGTGG - Intronic
914419775 1:147518742-147518764 TAGCCTCAGCCTGATTCCAGGGG + Intergenic
917463566 1:175254301-175254323 TATTTTCAGCCCAAAACAAGAGG - Intergenic
918198565 1:182245616-182245638 AAGTGTCAGACTAATTCAAGAGG - Intergenic
918598968 1:186330390-186330412 TAGTTTCAACCTGCTTAAAGAGG + Intronic
924270753 1:242330072-242330094 AGGTTTCAATCTAATTCAAGAGG - Intronic
1069358431 10:67614308-67614330 CAGTTTCAGGATGATTCAAGTGG + Intronic
1070265055 10:74894040-74894062 AAGTTTCAGGCTAATTCATAAGG - Intronic
1072740722 10:97907560-97907582 TGGTCTTAGCCTGATTCAAGTGG + Intronic
1076090514 10:127681525-127681547 TAGTTTAAGAGTATTTCAAGGGG - Intergenic
1078130988 11:8614030-8614052 TAGTTTCAGCAAAATTGAAGGGG + Exonic
1083232017 11:61328219-61328241 TGGTTTCAACCTTATTCAATTGG + Intronic
1083505142 11:63149713-63149735 TAGGTCCTGCCTAAATCAAGGGG + Intronic
1087184852 11:95178564-95178586 TAGTTTCAGCCTAATCTAATTGG - Intronic
1097954799 12:65472796-65472818 TAGTTTCAGCATAATTCTTCAGG - Intronic
1097987829 12:65803040-65803062 TAGTTTCAGCCTGATCCCACAGG + Intergenic
1098417607 12:70253780-70253802 TAGTTTCCCCTTAATTCAAGGGG + Intronic
1098983653 12:76986301-76986323 TAGTTTCAGTCTGATTCCATAGG - Intergenic
1100042227 12:90333966-90333988 TAACTTCAGCATAATCCAAGGGG - Intergenic
1102442402 12:112973743-112973765 TAGTTTCAGACCAATTCAGAAGG + Intergenic
1104113097 12:125722638-125722660 TACTTTCAGCCTAATCCCACAGG + Intergenic
1108051717 13:46449634-46449656 TAGTTTCGGCTTAATTGAAGTGG - Intergenic
1108521251 13:51248740-51248762 TAGTCTCATCCTAAATCAAAGGG + Intronic
1109539578 13:63756580-63756602 TAGTTTCGGCTTAATTGAAGTGG + Intergenic
1109544266 13:63823255-63823277 TAGTTTCGGCTTAATTGAAGTGG - Intergenic
1111563790 13:89988455-89988477 TACTTTCAGACTAATTCATGTGG + Intergenic
1113190497 13:107740060-107740082 TGGTTTCAGGATGATTCAAGTGG - Intronic
1115049063 14:29033939-29033961 TAGTTTCAACCTAACTGCAGGGG + Intergenic
1115718045 14:36127355-36127377 TAGTTCCAGCCACACTCAAGCGG - Intergenic
1116043294 14:39712424-39712446 TGATTTGACCCTAATTCAAGGGG - Intergenic
1120473308 14:84954774-84954796 TAATTTCAGCCTCATTTTAGTGG - Intergenic
1121993397 14:98582924-98582946 GAGTTTCAGCCTCATTCCTGGGG - Intergenic
1124028085 15:25985453-25985475 TAAATTCAACCTAATCCAAGAGG + Intergenic
1126820697 15:52500822-52500844 TAGTTCATGCCTAATCCAAGAGG + Intronic
1127681621 15:61303477-61303499 TAGTTTGAGCCTCATGAAAGTGG + Intergenic
1130728835 15:86468462-86468484 TTGATTCAGGCTAATTCCAGGGG + Intronic
1140941887 16:79729503-79729525 TAGTCTCAGCTTCATTCTAGGGG + Intergenic
1146805714 17:35863550-35863572 CAGTTTGGGCCTAATTTAAGAGG + Exonic
1156793507 18:41009326-41009348 TAGTTTCAGTCTAAGTCCAAAGG + Intergenic
1157210508 18:45738153-45738175 TAGACTCAGCCTAATATAAGAGG + Intronic
1158443718 18:57500592-57500614 CAGTCTCAGCCTAAATCAAGGGG + Intergenic
1162854869 19:13460515-13460537 AAATTTCAGCCTAATGCATGTGG + Intronic
925460509 2:4058952-4058974 TAGTCTCACCTTCATTCAAGGGG - Intergenic
926799467 2:16646939-16646961 TAGTTCCAGCCTAAGTCAGAAGG - Intronic
939001544 2:136741241-136741263 AAGTTGCAGCCAAATGCAAGGGG + Intergenic
943490032 2:188540984-188541006 TAGTTTCATCCTGAATCAGGAGG + Intronic
946377094 2:219317933-219317955 TAATTTAAGCCTAAAGCAAGTGG - Intergenic
947061359 2:226170160-226170182 TGGTTCCAGCCTAATTCCATTGG - Intergenic
947844362 2:233232256-233232278 TAGTCTCAGCCTGATCCCAGGGG + Intronic
1169644799 20:7798162-7798184 TAGTTTCAGCCTGATCCAATGGG - Intergenic
1173118371 20:40268073-40268095 TAGTCTCAGCCTCATTCCACAGG + Intergenic
1178611098 21:34081187-34081209 CAGTTTCAGCTTCATTAAAGTGG - Intronic
1182363545 22:29762757-29762779 TGGTTTCAGGATGATTCAAGTGG - Intronic
951513399 3:23529596-23529618 TAGTTTCATCATTTTTCAAGTGG + Intronic
952587823 3:34913545-34913567 TAGTTTCTGCACAAGTCAAGTGG + Intergenic
953054366 3:39376039-39376061 TAGTTTCATCTGAATTCAACAGG - Intergenic
957744238 3:84317933-84317955 TAGTTTTTGCCTACTTAAAGAGG + Intergenic
958459453 3:94375969-94375991 TAGTTACTGAATAATTCAAGGGG + Intergenic
959109534 3:102105420-102105442 CAGTTTCAGCCTGATTCCACAGG - Intronic
960901432 3:122558096-122558118 TAGTTCTGGCCTAATTCCAGGGG - Intronic
961727451 3:128941933-128941955 TATTTCTAGCCTAATTCAACTGG + Intronic
963242411 3:143020587-143020609 TATTTTCAACAGAATTCAAGAGG + Exonic
967612854 3:191528360-191528382 TAGTTTCAGGCTGAGTCCAGAGG - Intergenic
968237374 3:197041835-197041857 TAGCTACAGCCAAATTTAAGAGG + Intergenic
975258113 4:72263254-72263276 TGGTTTCAACATAATCCAAGGGG + Intergenic
975960757 4:79901593-79901615 TGGTTTCAGGATAATTCAAGTGG + Intronic
976554419 4:86433440-86433462 TAGTTTCAGGATAATTCCACAGG - Intronic
976796741 4:88942222-88942244 TTCTCTCTGCCTAATTCAAGAGG - Intronic
976932378 4:90583739-90583761 TAGTTTCAGCTAAAAACAAGAGG + Intronic
977059279 4:92237037-92237059 CAGTTTCAGCCTGATTCAACTGG + Intergenic
980114168 4:128663425-128663447 CAGTGTCAGCCAGATTCAAGGGG + Intergenic
980136882 4:128866630-128866652 TAGTATCACCCTACTTTAAGTGG - Intronic
981429041 4:144639785-144639807 TATCTTCAGCCTAATTCCAAGGG - Intergenic
985907552 5:2852833-2852855 TATTTTAATCCTAATTCAACTGG + Intergenic
993602077 5:89939026-89939048 TACTTTCAGTCTGATTCAATGGG + Intergenic
994313027 5:98298571-98298593 CAGTAACAGCCTAATACAAGTGG + Intergenic
1001473798 5:172035068-172035090 TAGTTTCAGCCTGATCCCACAGG + Intergenic
1002703511 5:181144075-181144097 GAGTTTTAGCCTAATTAGAGAGG - Intergenic
1006927402 6:37664674-37664696 TAGTCTCAGCCTGTTTCCAGGGG - Intronic
1010653656 6:78485421-78485443 TAGTTTAAGCCTTATTCACAAGG - Intergenic
1011040018 6:83019752-83019774 TGGTTTCAGCCTGATCCATGGGG + Intronic
1011399480 6:86944261-86944283 TAGTTTCAGCCTAATTCAAGGGG + Intronic
1012985842 6:105875437-105875459 GACTTCCAGACTAATTCAAGAGG + Intergenic
1013199092 6:107874795-107874817 TAGTCCCAGCCTAACTCAGGAGG - Intronic
1014181605 6:118390449-118390471 TAGTTTCTCCTTAATACAAGAGG + Intergenic
1014257578 6:119178341-119178363 ATGTTTCAGCCTAATCCATGGGG + Exonic
1014889156 6:126821085-126821107 TAATTTCACTCTAATTCAACAGG + Intergenic
1021040537 7:15856628-15856650 TAGATTCAGCCTAAAGGAAGTGG - Intergenic
1021732983 7:23614915-23614937 TAGATTCAGCATAATTCATAAGG + Intronic
1021856619 7:24863380-24863402 TTGCTTCAGCCAAAGTCAAGGGG - Intronic
1022889067 7:34677244-34677266 AAGTTTCTGCCTAATGGAAGAGG - Intronic
1024904540 7:54361643-54361665 AAGTTTAAACCAAATTCAAGTGG - Intergenic
1027365569 7:77454267-77454289 TAGTTTCAGCTTTATTCTATAGG + Intergenic
1032984976 7:137327783-137327805 TAGTTTCATCCTCATAAAAGGGG - Intronic
1033096384 7:138435213-138435235 CAGTTACAACCTAATTCTAGAGG + Intergenic
1035056048 7:156037505-156037527 GAGTTTCTGCCTATTTGAAGTGG + Intergenic
1035137864 7:156724820-156724842 TATTTTTAGCCTACTTAAAGGGG - Intronic
1039727467 8:40234300-40234322 AAGTTTCAGCCTCAAACAAGAGG + Intergenic
1039956503 8:42211067-42211089 TAGTTTCGGGATGATTCAAGAGG - Intergenic
1042022276 8:64380354-64380376 AGGTTTCAGCCTAAATAAAGTGG - Intergenic
1043747552 8:83894643-83894665 TAGTTGCAGCATATTTTAAGTGG + Intergenic
1044695774 8:94920966-94920988 TAGTTCTAGCCTTATTGAAGAGG - Intronic
1044825825 8:96195900-96195922 TTCTCTCAGCATAATTCAAGGGG - Intergenic
1046221995 8:111228543-111228565 GAATTTTAGCCAAATTCAAGAGG - Intergenic
1052047033 9:23805918-23805940 TAGTTTCAGCTTAGTCAAAGTGG + Intronic
1053250440 9:36569895-36569917 TAGATTCAGCATAATTCATAAGG - Intergenic
1053518904 9:38757034-38757056 CAGTTTCTGCCTATTTCAAATGG + Intergenic
1053590281 9:39506864-39506886 TAGTTCCACCCTACCTCAAGTGG + Intergenic
1053848035 9:42261025-42261047 TAGTTCCACCCTACCTCAAGTGG + Intergenic
1054576022 9:66858425-66858447 TAGTTCCACCCTACCTCAAGTGG - Intronic
1054887336 9:70212814-70212836 TAGTTTCAGCCTGATACCTGTGG + Intronic
1056848562 9:90060914-90060936 TAGTTACTGGCTAATTCAGGAGG + Intergenic
1058780960 9:108334528-108334550 AGGTTTCAGCATAAATCAAGAGG + Intergenic
1188103264 X:26116967-26116989 TGGTTTCAGCCTATTTCAGGTGG + Intergenic
1188182846 X:27076681-27076703 TAGTTTCAGCTTATTCCAACAGG + Intergenic
1189599301 X:42605370-42605392 TAGTTTTAGCCTAAAGCAATTGG - Intergenic
1195108932 X:101625777-101625799 GATTTTCAGCCAAATTCAAAAGG - Exonic
1197592459 X:128425268-128425290 CAGGTTCAGTCTATTTCAAGTGG - Intergenic
1199751838 X:150826968-150826990 TACTCTCAACCAAATTCAAGGGG - Intronic
1202032529 Y:20593215-20593237 TAGTTTCAGCCTAGGTGCAGTGG + Intergenic