ID: 1011399843

View in Genome Browser
Species Human (GRCh38)
Location 6:86948607-86948629
Sequence CTGAAGTAACAATCTAATTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 145}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011399835_1011399843 28 Left 1011399835 6:86948556-86948578 CCTCTCACCTCCCACTGGCAGAA 0: 1
1: 0
2: 2
3: 37
4: 356
Right 1011399843 6:86948607-86948629 CTGAAGTAACAATCTAATTGGGG 0: 1
1: 0
2: 0
3: 16
4: 145
1011399839_1011399843 17 Left 1011399839 6:86948567-86948589 CCACTGGCAGAAATTTGCAGGCT 0: 1
1: 0
2: 1
3: 13
4: 132
Right 1011399843 6:86948607-86948629 CTGAAGTAACAATCTAATTGGGG 0: 1
1: 0
2: 0
3: 16
4: 145
1011399838_1011399843 18 Left 1011399838 6:86948566-86948588 CCCACTGGCAGAAATTTGCAGGC 0: 1
1: 0
2: 0
3: 11
4: 123
Right 1011399843 6:86948607-86948629 CTGAAGTAACAATCTAATTGGGG 0: 1
1: 0
2: 0
3: 16
4: 145
1011399836_1011399843 21 Left 1011399836 6:86948563-86948585 CCTCCCACTGGCAGAAATTTGCA 0: 1
1: 0
2: 0
3: 14
4: 185
Right 1011399843 6:86948607-86948629 CTGAAGTAACAATCTAATTGGGG 0: 1
1: 0
2: 0
3: 16
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011399843 Original CRISPR CTGAAGTAACAATCTAATTG GGG Intronic
903574098 1:24327307-24327329 TGGAACTTACAATCTAATTGGGG - Intronic
904549210 1:31301149-31301171 ATGAATTAACAATTTAAATGGGG + Intronic
906931026 1:50169538-50169560 CTGAATTTACATTCTGATTGGGG - Intronic
908170452 1:61499381-61499403 AAGAAGTAACAATCTAAATCTGG + Intergenic
909284827 1:73802670-73802692 CTTAATTAGCAATTTAATTGAGG - Intergenic
911888576 1:103337125-103337147 CTGAAGTAACATTTTAAAAGGGG + Intergenic
913564913 1:120063449-120063471 CTCAGGTAACATTCTAATGGAGG + Intronic
913633217 1:120730114-120730136 CTCAGGTAACATTCTAATGGAGG - Intergenic
914285499 1:146222799-146222821 CTCAGGTAACATTCTAATGGAGG + Intronic
914546530 1:148673554-148673576 CTCAGGTAACATTCTAATGGAGG + Intronic
914620035 1:149397116-149397138 CTCAGGTAACATTCTAATGGAGG - Intergenic
915731836 1:158059422-158059444 CTGAATTCTCAAGCTAATTGTGG - Intronic
920595614 1:207266798-207266820 GTGAAGTGATAATCTCATTGTGG - Intergenic
921421724 1:214956654-214956676 CGGAAGTAGCAATTTAATTGGGG - Intergenic
922968426 1:229713491-229713513 CTGTAGTAACAATCTATTATGGG + Intergenic
1063466508 10:6248792-6248814 GTGAACTAAAAATCTCATTGTGG - Intergenic
1066006767 10:31153099-31153121 ATGAGGTATCAATCTCATTGTGG - Intergenic
1068496387 10:57789592-57789614 ATTAAGTACCACTCTAATTGGGG - Intergenic
1068522915 10:58096715-58096737 AGGAACTTACAATCTAATTGGGG - Intergenic
1069769063 10:70886263-70886285 CTGATGTAATAATCTCATGGAGG - Intronic
1071131748 10:82402265-82402287 CAGAAGTGACATTCTATTTGGGG - Intronic
1071473346 10:86003443-86003465 CTGAAGTAATATTCTAAATGGGG - Intronic
1074175961 10:111003154-111003176 ATGAAGTAACTATATAATTGAGG - Intronic
1076183162 10:128426422-128426444 CTTAAATAAAAATATAATTGTGG + Intergenic
1078682951 11:13497325-13497347 CTGGAGCAACACTCTAAGTGAGG - Intergenic
1084762608 11:71283462-71283484 ATGAAGGCACAATCTAATTGTGG - Intergenic
1087863192 11:103189739-103189761 CTGAAGAATCATTCTATTTGGGG + Exonic
1087983634 11:104649771-104649793 CAGAAGTCATAATGTAATTGTGG - Intergenic
1089797665 11:120995385-120995407 CAGAGATAACAATCTAATTGAGG + Intergenic
1091340551 11:134809455-134809477 CTGAAGTAATATATTAATTGAGG + Intergenic
1091571176 12:1687819-1687841 CTGAAAGAACACTCTAATTCTGG + Intergenic
1092295591 12:7195870-7195892 TTGAGGCAACAGTCTAATTGGGG + Intronic
1093269388 12:17040271-17040293 CAGAAGTAACAAATTATTTGTGG + Intergenic
1093723325 12:22472053-22472075 CTGAAGTGAACATCTAAATGTGG + Exonic
1095454953 12:42373409-42373431 CTGAAGGGACAATATATTTGGGG + Intronic
1095797412 12:46235215-46235237 CAACAGTAACAATCTAATTAAGG + Intronic
1098426838 12:70373716-70373738 CTTTAGAAACAATCTAATTTGGG + Intronic
1099043375 12:77684138-77684160 GTGAAGTGATAATCTTATTGTGG + Intergenic
1101194332 12:102367458-102367480 AAGAATTTACAATCTAATTGAGG - Intergenic
1102849682 12:116228821-116228843 CTGAGGTAAGAATCTGAATGTGG - Intronic
1106631885 13:31482658-31482680 CAGAAGCAAAAATCTCATTGAGG + Intergenic
1108843947 13:54655558-54655580 ATGAAATAACAATATAATTTAGG + Intergenic
1109602559 13:64650892-64650914 CTGAAGGAATAATTTATTTGAGG - Intergenic
1112067144 13:95805227-95805249 CTGAGGTAATAATTTCATTGTGG - Intronic
1113058843 13:106299252-106299274 CTGAGGTAAATTTCTAATTGTGG - Intergenic
1116727547 14:48580323-48580345 CGGAAGTAAGAATTCAATTGAGG + Intergenic
1118945512 14:70382629-70382651 CTGAAGTAGCAAGTTAATTCTGG - Intronic
1122031908 14:98918591-98918613 CTGAAGTCCAAATCTAACTGGGG + Intergenic
1123486629 15:20746229-20746251 ATGAAGGAACAATCTAACTACGG + Intergenic
1123543119 15:21315279-21315301 ATGAAGGAACAATCTAACTACGG + Intergenic
1130294084 15:82631171-82631193 CTGAAAAAAAAATCTAATTTAGG + Intronic
1202951437 15_KI270727v1_random:42409-42431 ATGAAGGAACAATCTAACTACGG + Intergenic
1137296948 16:47103631-47103653 CTGAAGTAATAATTTTCTTGAGG - Intronic
1137821465 16:51449549-51449571 ATGAATAAACACTCTAATTGGGG - Intergenic
1139619458 16:68125477-68125499 TTGAAGTAAAAATTTAATTTTGG - Intronic
1147486968 17:40825411-40825433 CAGTAGTTACAGTCTAATTGAGG + Intronic
1148883840 17:50756905-50756927 CTGAGGTAACAACCTAACTTGGG - Intergenic
1156802220 18:41129948-41129970 GTGAAAAAATAATCTAATTGTGG + Intergenic
1157698967 18:49747431-49747453 CTGAACTGACAATCCCATTGGGG + Intergenic
1159114475 18:64098467-64098489 CATAAGTAACATTCTAATTTGGG + Intergenic
1160158598 18:76452798-76452820 CTGAATACACAATCTAATTATGG + Intronic
1160335367 18:78034019-78034041 CTGAAGTCACCCTCTATTTGCGG + Intergenic
1164953727 19:32362391-32362413 ATGAAAGAACAATCTAATTCTGG - Intronic
930506778 2:52292336-52292358 CACAAGTAACAATTTATTTGGGG - Intergenic
931245471 2:60489149-60489171 CTAAAGCAACAGTTTAATTGGGG - Intronic
932508621 2:72262393-72262415 CTGAAGTCTCAAACTTATTGAGG + Intronic
932548713 2:72743598-72743620 TTGAACTTACAATCTAGTTGAGG - Intronic
933402514 2:81817137-81817159 CTGAAGTATCTATCCAATAGCGG - Intergenic
934512435 2:94956367-94956389 CTGATGGAACAATCTTGTTGTGG - Intergenic
939606849 2:144264251-144264273 CTGAAAAGACAATCTTATTGTGG + Intronic
940195262 2:151087429-151087451 CAGTAGCAACAATCTAATTGAGG + Intergenic
940723111 2:157303681-157303703 CTGAGGAAACTATTTAATTGAGG - Intronic
943534004 2:189123976-189123998 CTTAAGTCACACTCTAAATGTGG + Intronic
944271718 2:197791099-197791121 CTAAAGTAAGAATCAAATGGTGG - Intergenic
944366727 2:198929493-198929515 CTGAATTAACAACCTAGATGTGG - Intergenic
944671821 2:202000616-202000638 CTGGAGGAAAAATATAATTGAGG + Intergenic
944761039 2:202814007-202814029 CAGAAGTATCAAACTGATTGGGG - Intronic
945142780 2:206705010-206705032 TTGAAGTAACAGTCTCTTTGTGG + Intronic
1177194835 21:17892933-17892955 ATGAAATAACATACTAATTGTGG + Intergenic
1178625567 21:34215231-34215253 CAGAAATAACAAACTATTTGAGG - Intergenic
1181684310 22:24517854-24517876 CTGAAGAAACAATCTAAAAGAGG + Intronic
1184749351 22:46475829-46475851 CAGAAGTTAGAATCTAATTCAGG + Intronic
951011433 3:17686214-17686236 ATGTAGTCACAATCTAATTAGGG + Intronic
951356724 3:21676343-21676365 CAGAAGAAACAATCACATTGAGG - Intronic
951661210 3:25068719-25068741 CTGAAGGATGAATCTGATTGAGG + Intergenic
951983407 3:28590707-28590729 TTGATGCAACAATTTAATTGTGG + Intergenic
955583971 3:60456371-60456393 GTGAAGTAACAATTCAATTCTGG - Intronic
955904470 3:63792342-63792364 TTGAAGTAGCTATATAATTGTGG - Intergenic
956251026 3:67233954-67233976 CTGAATAAATAATGTAATTGCGG - Intergenic
957287470 3:78235063-78235085 CTGTTGTAACAATTTATTTGTGG + Intergenic
957805646 3:85145229-85145251 GTGAAGTAACAAAATAAATGTGG - Intronic
958007476 3:87831215-87831237 ATGAAGTAATAATCTAATCAAGG + Intergenic
959450915 3:106499007-106499029 CTGAAGTTACAATTTAATTATGG - Intergenic
962301648 3:134249163-134249185 CTGAATTAAAACTCTACTTGGGG - Intronic
967216066 3:187211652-187211674 ATGAAGTTACAATCTAAATTGGG + Intergenic
967638475 3:191833640-191833662 CTGCAGTGACAACCTACTTGAGG - Intergenic
967702615 3:192611015-192611037 CAGAAGTTAAAATGTAATTGGGG - Intronic
971069495 4:23075162-23075184 CTGATGTAACAAACTCATGGTGG + Intergenic
972748095 4:41960514-41960536 TTGATGTTAAAATCTAATTGTGG + Exonic
973959451 4:56095294-56095316 CTGAACTAACATTTTAGTTGGGG + Intergenic
974488047 4:62529155-62529177 CTGCAGTTACAATTTAACTGTGG - Intergenic
974981462 4:68962568-68962590 ATGTAGTAACAATTTTATTGAGG - Intergenic
975190427 4:71454245-71454267 GAGAAGTAACCAACTAATTGTGG - Intronic
975485440 4:74930422-74930444 CGGAAGGAAGAATATAATTGAGG + Intergenic
975972939 4:80064051-80064073 CTGAATTAAAAATTTACTTGTGG - Intronic
977353026 4:95912271-95912293 CTGGGGAAACAATCTAATTTTGG - Intergenic
978392061 4:108237405-108237427 TTGAAGTAATTATCTGATTGTGG + Intergenic
978715417 4:111836907-111836929 CTGAGGTATCAATCTAGTTGCGG - Intergenic
980185207 4:129452303-129452325 CTGAAAATACAATCTAAATGTGG - Intergenic
981167518 4:141579309-141579331 AGGAATTAAAAATCTAATTGGGG + Intergenic
981894802 4:149785932-149785954 CTGAAGAAACAATGGAATTTTGG - Intergenic
981920671 4:150080829-150080851 CTGAAGAGACAATTTAATTTTGG - Intronic
987309287 5:16667218-16667240 CTGAAGAAACAAGATAACTGAGG + Intronic
988438130 5:31200485-31200507 ATGAAGTAACAAAATAAATGTGG - Intronic
988853857 5:35206881-35206903 CTGATGTAAAATTCTAAATGAGG + Intronic
989985738 5:50695352-50695374 CTGAAGTAACAACCTAGTGCAGG + Intronic
991342787 5:65629909-65629931 CTGAAGGAACAGACTAATTCTGG + Exonic
993334688 5:86643774-86643796 CAGAAATAACCATCTAAGTGTGG - Intergenic
993491262 5:88553101-88553123 TTGAAACAATAATCTAATTGTGG + Intergenic
993612011 5:90065776-90065798 TTGAGGAAAAAATCTAATTGTGG + Intergenic
994872733 5:105374253-105374275 GTGACGTAATAATCTCATTGTGG + Intergenic
1001596313 5:172901126-172901148 CTTAAGTTACAATCTCATGGTGG - Intronic
1001653878 5:173333593-173333615 CTGAAGGAAGAATCTTTTTGTGG + Intergenic
1004067075 6:12257952-12257974 CTCAAGTAATAATCAAACTGAGG + Intergenic
1004743016 6:18481365-18481387 CAGAAATAACAATCTAGTTAAGG - Intergenic
1009884324 6:69606426-69606448 AAGAAATAAAAATCTAATTGAGG - Intergenic
1010695309 6:78966380-78966402 CTGAAATAAAATTATAATTGCGG + Intronic
1011399843 6:86948607-86948629 CTGAAGTAACAATCTAATTGGGG + Intronic
1012077381 6:94707684-94707706 CTGAAATAAAGATCTAATTCAGG - Intergenic
1012304998 6:97644487-97644509 CTCTAGTAAAGATCTAATTGTGG + Intergenic
1013669039 6:112378170-112378192 CTGAATTAGCAATTTAATTGAGG + Intergenic
1015021043 6:128475360-128475382 CTGAAATAAAAATCTAATCATGG - Intronic
1017060466 6:150479859-150479881 CTGCAGTAACAAATAAATTGTGG + Intergenic
1021344748 7:19511876-19511898 CTGAAATAACAATTTAATTTAGG - Intergenic
1023739042 7:43261597-43261619 CTGAAGGTACCATGTAATTGGGG - Intronic
1027960072 7:84934390-84934412 CTGAAGTAAAAATGTCATTTTGG - Intergenic
1035653710 8:1289384-1289406 CTGAACTAACAGTGGAATTGAGG - Intergenic
1035943930 8:3937783-3937805 TTGAAGTAACATTCTATGTGAGG - Intronic
1036243545 8:7098104-7098126 CTCAATTAACCATTTAATTGTGG + Intergenic
1038379238 8:27076846-27076868 CTGAAATTAAAATGTAATTGAGG + Intergenic
1038900908 8:31842651-31842673 CTCAAGAAATAGTCTAATTGAGG - Intronic
1040740929 8:50574413-50574435 CTAAAGTAAAAATATAATTAAGG - Intronic
1044108930 8:88247798-88247820 CTGCAGTAACAATGTCATGGGGG + Intronic
1047240136 8:123079809-123079831 CTGAACTTACAATATACTTGAGG - Intronic
1047268728 8:123333674-123333696 CAGAAGTCACCATCTAATTGTGG - Intronic
1048903978 8:139069217-139069239 CTGAACTGACAATGTAGTTGGGG + Intergenic
1049035775 8:140074717-140074739 GTGGAGTCACAATCTGATTGTGG + Intronic
1049366659 8:142241145-142241167 CAGAAGTAACAAACGAATTCAGG + Intronic
1050087663 9:1983220-1983242 CTGAAGTAACAAATTACTTGGGG + Intergenic
1052007242 9:23362905-23362927 CTAAAATTGCAATCTAATTGTGG + Intergenic
1052619022 9:30881395-30881417 CTGAGTTAACAATAAAATTGAGG - Intergenic
1055016504 9:71624298-71624320 ATGATGAAACAATCTAATTGTGG + Intergenic
1055901748 9:81247318-81247340 GTGAGGTAAAAATCTCATTGAGG - Intergenic
1059379289 9:113910603-113910625 CTGAAGTAAAAATGTAATGGTGG - Intronic
1186364807 X:8880078-8880100 CTGAAGTAACAAGGAAGTTGGGG + Intergenic
1187476678 X:19617373-19617395 ATGAAGAAACAATCTTTTTGAGG - Intronic
1191764027 X:64677146-64677168 GTGAAATAATAATCTCATTGGGG - Intergenic
1194648059 X:96482577-96482599 CAGAAGAAACAATCCAACTGAGG + Intergenic
1194666200 X:96680314-96680336 CAGAATTAAAAATCTAATTGAGG - Intergenic
1196104525 X:111882190-111882212 CTGAAATAAAAATATAATTCTGG + Intronic
1197827252 X:130603158-130603180 CTGATGAAAAAATCTAATTCTGG + Intergenic
1199620856 X:149699449-149699471 CTGAAGTCACAATCTTCTAGGGG - Intronic