ID: 1011400777

View in Genome Browser
Species Human (GRCh38)
Location 6:86959134-86959156
Sequence CTGAGTTTCCCCAAGGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 504
Summary {0: 1, 1: 0, 2: 7, 3: 91, 4: 405}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011400777_1011400784 30 Left 1011400777 6:86959134-86959156 CCCTCTTCCTTGGGGAAACTCAG 0: 1
1: 0
2: 7
3: 91
4: 405
Right 1011400784 6:86959187-86959209 GGATGAGGCCTACCACATTGTGG No data
1011400777_1011400781 9 Left 1011400777 6:86959134-86959156 CCCTCTTCCTTGGGGAAACTCAG 0: 1
1: 0
2: 7
3: 91
4: 405
Right 1011400781 6:86959166-86959188 TCTTGAGGCCTTCAACTGATTGG 0: 7
1: 82
2: 327
3: 688
4: 963
1011400777_1011400782 15 Left 1011400777 6:86959134-86959156 CCCTCTTCCTTGGGGAAACTCAG 0: 1
1: 0
2: 7
3: 91
4: 405
Right 1011400782 6:86959172-86959194 GGCCTTCAACTGATTGGATGAGG 0: 149
1: 472
2: 754
3: 904
4: 894
1011400777_1011400780 -6 Left 1011400777 6:86959134-86959156 CCCTCTTCCTTGGGGAAACTCAG 0: 1
1: 0
2: 7
3: 91
4: 405
Right 1011400780 6:86959151-86959173 ACTCAGTCTTTTTTCTCTTGAGG 0: 1
1: 1
2: 6
3: 51
4: 437

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011400777 Original CRISPR CTGAGTTTCCCCAAGGAAGA GGG (reversed) Intronic
900288222 1:1912035-1912057 CTGAGGTCCCCCAAGGAAGAAGG - Intergenic
901908922 1:12438583-12438605 CTGTGTTTCCCCACTGAACAGGG - Intronic
902753370 1:18532908-18532930 CTTAGCTTCCCCTAGCAAGACGG - Intergenic
902913107 1:19615789-19615811 CTGAGATTCTCCAAGGATAAAGG + Intronic
903434669 1:23338062-23338084 CTGTGTTTTCCCAGGGTAGAAGG - Intronic
903454414 1:23477258-23477280 CTCAGCCTCCCCAAGGCAGATGG - Intronic
904237437 1:29124154-29124176 CTCAGTTTCCCCATGTAGGAAGG - Intergenic
904458343 1:30660754-30660776 CTGAGGGTCCCCTAGGAAGAAGG - Intergenic
904493247 1:30873034-30873056 CAGATCTTCCCCGAGGAAGAGGG - Intronic
904966565 1:34378848-34378870 CTCAGTTTTCCCAAGGATGTAGG + Intergenic
905132901 1:35774829-35774851 CAGTGTTTCCCCAGGGACGAAGG - Intergenic
905339742 1:37270344-37270366 CTCAGTTTCATGAAGGAAGAAGG + Intergenic
905356176 1:37386445-37386467 CTGACTTTCCTGAAGGGAGAAGG - Intergenic
905659476 1:39710397-39710419 CTGAGGTATGCCAAGGAAGAAGG - Intronic
907091628 1:51730153-51730175 CTGAGAACTCCCAAGGAAGAGGG - Intronic
907486284 1:54780544-54780566 CTTAGTTTCCCCCAAGAAGAGGG + Exonic
907629605 1:56067027-56067049 CTTAATTTCCACAAAGAAGAAGG + Intergenic
908261331 1:62341478-62341500 CTGATTTCCCCTAAGGAGGAAGG - Intergenic
908327406 1:63036695-63036717 CTCAGTTTCCCCAACTGAGAAGG - Intergenic
910109465 1:83667290-83667312 CTGAGGTTCCCTAAGGAAAATGG + Intergenic
910366006 1:86466200-86466222 CTTAGCTTTCCCCAGGAAGAGGG - Intergenic
911829249 1:102530033-102530055 CTGACCTTCCCCTAGGAAGAGGG + Intergenic
912972505 1:114297316-114297338 CTGACTTCCCCTAAGCAAGAAGG + Intergenic
913120762 1:115738381-115738403 CTCTGTTTCCCCAGTGAAGAAGG - Intronic
913447124 1:118961437-118961459 CTCCTTCTCCCCAAGGAAGATGG - Intronic
914000430 1:143690104-143690126 TTGAGTATTGCCAAGGAAGAAGG - Intergenic
914377504 1:147085130-147085152 CTGGTCTCCCCCAAGGAAGAGGG + Intergenic
914852346 1:151324442-151324464 CTGAGTTTCTATAAGGAAAAAGG - Intronic
915143386 1:153780310-153780332 CAGAGGTTCTCCAAGGACGAAGG - Intergenic
915249401 1:154577694-154577716 CTTGGTTTCCTCAGGGAAGAGGG - Exonic
915564811 1:156707388-156707410 CTGGGCTTCTGCAAGGAAGAGGG + Intergenic
916157011 1:161862106-161862128 CTGTATTTCCCCCAGGAGGATGG + Intronic
916726734 1:167530189-167530211 CTGATCTTCCCAGAGGAAGAAGG - Intronic
918362711 1:183775141-183775163 GTGAGTATTGCCAAGGAAGAAGG - Intronic
919765480 1:201124590-201124612 TTGAGGGTTCCCAAGGAAGATGG + Intronic
921250616 1:213294271-213294293 CTGAGTTTTGCCAAGGAGGGTGG + Intergenic
922211579 1:223490563-223490585 CTGGGTTTCCCCAAGTCAGATGG - Intergenic
922890809 1:229060719-229060741 CTGAAATTTCCCAAGGAATATGG - Intergenic
923441226 1:234022444-234022466 GTGAGGTCCCCAAAGGAAGAGGG - Intronic
923536468 1:234856001-234856023 CTGATCTCCCCCAAGGAAGAGGG - Intergenic
923735820 1:236605768-236605790 CTGACATTCTCCAGGGAAGACGG - Intergenic
923771632 1:236942589-236942611 CTAAGGTTCCCTGAGGAAGAAGG - Intergenic
924064137 1:240207045-240207067 CAGACTTCCCCCACGGAAGAGGG + Exonic
924136894 1:240976583-240976605 CAGATTTTCTCCAAGGAAGAGGG + Intronic
924320478 1:242843640-242843662 ATGAGTATTGCCAAGGAAGACGG + Intergenic
924608097 1:245552301-245552323 CTGACTTTCCCTGAGCAAGAAGG - Intronic
924932020 1:248740325-248740347 CTGAGTTTTCCCTGAGAAGAAGG + Intronic
1062943049 10:1438853-1438875 CTGAGTCTCCCCCAGGATGGAGG + Intronic
1062943080 10:1438989-1439011 CTGAGTCTCCCCCAGGATGGAGG + Intronic
1062943270 10:1439854-1439876 CTGAGTCTCCCCTAGGATGGAGG + Intronic
1062943339 10:1440173-1440195 CTGAGTCTCCCCCAGGATGGAGG + Intronic
1063875880 10:10477882-10477904 CTGATGTTCCCCAAGGAAAATGG + Intergenic
1064658491 10:17580588-17580610 CTGACATGCCCCAGGGAAGATGG - Intergenic
1065291529 10:24235075-24235097 CTGAGGTCCCCCAAAGAAAAAGG - Intronic
1065387729 10:25149998-25150020 CTGACTTTCCCCAAGCAAGAAGG - Intergenic
1065481321 10:26197102-26197124 CCGAGTATTACCAAGGAAGAAGG + Intronic
1067220649 10:44341751-44341773 CTGAGGTACCCTGAGGAAGAGGG - Intergenic
1067671666 10:48329092-48329114 CTGAGTTTCCCCATCTATGAGGG - Intronic
1068159037 10:53239935-53239957 ATGAGTTTCCCGAAGAAACATGG + Intergenic
1068437503 10:57011546-57011568 CTGAGTTTGCCCAATTAAGAAGG - Intergenic
1068700637 10:60015965-60015987 CCGAGTATTGCCAAGGAAGAAGG - Intergenic
1069546580 10:69333581-69333603 CTCAGGTTCTCCTAGGAAGAGGG + Intronic
1069584424 10:69588450-69588472 CTGAGGTTGCCAAAGGAAGTGGG + Intergenic
1069662421 10:70132443-70132465 CTAAGTTTTCCTAAGGAAGATGG - Intronic
1069874111 10:71551317-71551339 CTGACCTTCCCCCAGGAAGTGGG - Intronic
1070734973 10:78856991-78857013 CTCAGTTTCCCCAAGGGTGCAGG - Intergenic
1070973689 10:80588103-80588125 ATGAGTATTGCCAAGGAAGAAGG + Intronic
1072784992 10:98273362-98273384 CTGAGCTTCCCCAGGCAAGGAGG - Intergenic
1072924534 10:99604981-99605003 CTGAGGTTTCCCAGAGAAGAAGG + Intergenic
1073764958 10:106672097-106672119 GTGAGTTTGCTCAAGAAAGACGG - Intronic
1074958665 10:118418683-118418705 CAGAGGTTCCCAAATGAAGAAGG + Intergenic
1075398469 10:122144157-122144179 TTGACCTTCCCCAAGGAAAAGGG - Intronic
1075872633 10:125781906-125781928 CTGAGATTTCCCAAGCACGATGG + Intergenic
1077265936 11:1650186-1650208 CTGAGTTCCCACAAGAAGGAAGG - Intergenic
1078369861 11:10735700-10735722 CTAAGTTTCTCCAAGGAGGCGGG - Intergenic
1078468977 11:11571908-11571930 CTGTGTTTCCCCAGGGCAGAGGG - Intronic
1079724958 11:23869205-23869227 ATGAGTATTGCCAAGGAAGAAGG - Intergenic
1080642718 11:34167076-34167098 CTGAGTTGCCTCAAGGAAAGGGG - Intronic
1081701429 11:45155218-45155240 CTCACTTTCCCCAAGGGAAAGGG + Intronic
1081750160 11:45504842-45504864 CTGATCTCCCCCAAGGAAGAAGG - Intergenic
1082101642 11:48177719-48177741 CTGAGTTTGGCCAAGGAAAGGGG - Intergenic
1083292658 11:61698577-61698599 GTGAGCTTCCCCAGGGAAGCAGG - Intronic
1083971109 11:66076135-66076157 CTGAGCTTCCACAGGGACGATGG - Intronic
1084326490 11:68403383-68403405 CTGAGCTGCCCCAAACAAGACGG - Intronic
1084403469 11:68958091-68958113 CTGACTTTGCCCAAGGCTGATGG - Intergenic
1086906478 11:92423797-92423819 CTGAGGTTTCCCAAAGAAGAAGG - Intronic
1087708377 11:101521227-101521249 CTGAGGTTGCACAAGGAAGCTGG - Intronic
1089125767 11:116175488-116175510 CTGAGTTTCCTTAGGGATGAAGG - Intergenic
1089897524 11:121946656-121946678 ATGAGTATCCCTAGGGAAGAAGG + Intergenic
1090354810 11:126133033-126133055 CTGAGTTTCCCAGTGGAAGAGGG - Intergenic
1091030598 11:132184174-132184196 CTGTGTTTACCCACAGAAGAGGG + Intronic
1091170589 11:133516650-133516672 CTCAGTGTCCCCAGGGTAGATGG + Intronic
1092314559 12:7396650-7396672 CTGAAGTCCCCCAAGAAAGAAGG + Intronic
1092345359 12:7710107-7710129 CAGAGATTCCCCAGGCAAGAGGG + Intergenic
1092719212 12:11424320-11424342 ATGGGTTTCACCAAAGAAGAAGG - Intronic
1093017171 12:14166249-14166271 CTGAGATCCCCTAAGGAAGACGG + Intergenic
1093273494 12:17095499-17095521 CTGACCTTCCCCAAGTAAGAAGG - Intergenic
1094185690 12:27640254-27640276 CTCACTTTCCCAAAGGAACAGGG - Intronic
1094753435 12:33439500-33439522 ATGAGTTTCCACAAGGAGGACGG - Exonic
1095731802 12:45513636-45513658 CTGACCTCCCCCAAGGAAGAGGG + Intergenic
1096258104 12:50074969-50074991 GAGAGCTTCCCCTAGGAAGAGGG - Intronic
1098197111 12:68013753-68013775 TTGACTGTCCCCAAGTAAGAAGG + Intergenic
1098435476 12:70464125-70464147 ATGAGTATTGCCAAGGAAGAAGG + Intergenic
1098688729 12:73459418-73459440 CAGAGTTCCCCCTAGCAAGAAGG - Intergenic
1100677524 12:96884256-96884278 CTGAGATTGCCCAGGGAAGAGGG - Intergenic
1101934454 12:109046068-109046090 CTGACTTCCCCCAAGCAAGAGGG - Intronic
1102223155 12:111208442-111208464 CTGGGTTTCCCCAACCAGGAGGG - Intronic
1102442905 12:112977326-112977348 CTGAGCTCCCCCAAGGAAGAGGG - Intergenic
1102813981 12:115847638-115847660 CTGAAGTTCCCAGAGGAAGAGGG + Intergenic
1102870561 12:116410821-116410843 CTGAATTTCCCCAGAGAAGCTGG + Intergenic
1102992726 12:117326754-117326776 CTTTGTTTCCCCAAGGAAGAGGG - Intronic
1102996888 12:117358353-117358375 CGGTCCTTCCCCAAGGAAGATGG + Intronic
1104120106 12:125790827-125790849 CCGAGTATTGCCAAGGAAGAAGG - Intergenic
1104260886 12:127181079-127181101 CTCAGTTTCCCCAAAGAATAAGG - Intergenic
1104443507 12:128814613-128814635 CTGCATTTCCCCAAGGAGGCGGG - Intronic
1107541480 13:41393327-41393349 CTTAATTTCCCAAAGGAAAAGGG + Intergenic
1108383270 13:49874619-49874641 ATGAGTATTGCCAAGGAAGAAGG - Intergenic
1109071172 13:57771293-57771315 TTTATTTTCCCCAAGGAAGGGGG - Intergenic
1109311575 13:60700598-60700620 CTGAGGTTTTCCAAAGAAGAAGG - Intergenic
1109501269 13:63238791-63238813 ATGAGTTTTGCCAGGGAAGAAGG - Intergenic
1109522136 13:63527523-63527545 CTGAATATGGCCAAGGAAGAAGG + Intergenic
1112608044 13:100927336-100927358 CTGAGTATAAACAAGGAAGAGGG + Intergenic
1112884674 13:104154712-104154734 CTGACATCCCCCAAGGAAGAGGG - Intergenic
1112999216 13:105612855-105612877 CTGAGGTTCCCTGAGGAAGAAGG + Intergenic
1113038067 13:106073010-106073032 CAGATTTTCCTCAATGAAGAGGG - Intergenic
1113506547 13:110820957-110820979 CTCAGTTCCACCAAGGCAGAAGG - Intergenic
1113779189 13:112966375-112966397 CAGAGGTTCCCTGAGGAAGAGGG - Intronic
1114042119 14:18688628-18688650 CTGAGTCTCACCAACAAAGAGGG - Intergenic
1116112407 14:40603737-40603759 CTAAGTTTCCACAAGGAGAAAGG - Intergenic
1116617338 14:47155388-47155410 CTGGGTTTCCCGAAGGACCATGG - Intronic
1116666088 14:47777477-47777499 CTGTGTTTCCCAAAGAAACAGGG - Intergenic
1117717628 14:58597311-58597333 CTGAGGTCCCCCGAGGGAGAAGG - Intergenic
1118409360 14:65461745-65461767 ATGAGTATTGCCAAGGAAGAAGG + Intronic
1119380216 14:74223774-74223796 CTCATTTTCCCCAAGTAATAGGG - Intergenic
1119850738 14:77864876-77864898 CTGACCTTCCCCAAGCAAGAAGG - Intronic
1119952292 14:78757599-78757621 CTGCATTTCCCAAAGGAGGATGG + Intronic
1120021317 14:79534058-79534080 CTGATTTTTTCCAAGGAAGAAGG - Intronic
1120468534 14:84893085-84893107 CTGAGGTCCCCTGAGGAAGAAGG - Intergenic
1121489461 14:94347609-94347631 CTGACTTTCCCCATGTCAGAAGG + Intergenic
1121924477 14:97915396-97915418 TTGAATTTCCCAAAGGAAGGGGG - Intergenic
1122000089 14:98640738-98640760 CCGAGTATTGCCAAGGAAGAAGG - Intergenic
1122880287 14:104687797-104687819 CTGACTTTCCCCCAGGCAGGTGG + Intergenic
1124062842 15:26310684-26310706 ATGAGTATTGCCAAGGAAGAAGG - Intergenic
1124479294 15:30063847-30063869 CTGAGGTTTCCTGAGGAAGAAGG + Intergenic
1124687673 15:31796397-31796419 CTGAGCTTCCCCAAAGAAGAAGG - Intronic
1124885109 15:33678045-33678067 CGGAATTTCCCCAACGATGATGG - Intronic
1125733103 15:41905249-41905271 CGGAGAATCCCCAAGGAACAAGG - Intronic
1125748228 15:42011810-42011832 CTGGGTTGTCCCAAGGATGAGGG + Intronic
1127309860 15:57743127-57743149 CTGTGCTTCACCCAGGAAGAAGG - Intronic
1128053582 15:64683660-64683682 CTGAGTCACCCCAACCAAGAGGG + Exonic
1128444868 15:67750283-67750305 CCAAGTTTCCACAAGGAAGATGG - Intronic
1129361319 15:75026362-75026384 CTGAGTTTACCCCAGGGAGTGGG - Intronic
1129692827 15:77723562-77723584 CTCAGTTTCCCCAACTAAAAGGG - Intronic
1130945242 15:88546275-88546297 CTCAGTTTCCCTATGGGAGAAGG + Intronic
1130957770 15:88639348-88639370 CTGAGGGTCCCCAAGGAACATGG + Exonic
1131433074 15:92402012-92402034 CTTAGTATCCCAAAGGAAAAAGG - Intronic
1131792504 15:95980500-95980522 CTGAGTTTCCCCCAGAAAGCAGG + Intergenic
1132297512 15:100751755-100751777 CTGAGGTCCCCCAAGGAAGAAGG - Intergenic
1132414100 15:101608404-101608426 CTGAGTGCCCCCAGGGCAGAAGG - Intergenic
1132724774 16:1333912-1333934 CTCAGTTTCCCCAGGGCCGAGGG - Intronic
1133213833 16:4278595-4278617 CTCTGTGTCCCCAAGGAACATGG + Intergenic
1133517026 16:6519369-6519391 CTGGGTTTTCCCAAGGTGGAGGG - Intronic
1133600509 16:7335770-7335792 CTGATTTTCCTAAAGGAGGAAGG - Intronic
1134422539 16:14107820-14107842 GTGAGGTACACCAAGGAAGAGGG + Intronic
1135406231 16:22199953-22199975 TTGAGTTTCAACAAGGAAAATGG - Intergenic
1135737448 16:24943480-24943502 CGGAGTTCCCCCAGGTAAGACGG + Intronic
1137762523 16:50952144-50952166 CTCAGTTTACCCAAGGATAAAGG - Intergenic
1138259571 16:55605682-55605704 CTGAGGTCCCCCAAAGAACAGGG - Intergenic
1138369208 16:56511532-56511554 CTGACCTCCCCCAAGGAAGAAGG + Intronic
1138475047 16:57265678-57265700 CTGAGATTCCCTTTGGAAGATGG - Intronic
1139067791 16:63339996-63340018 ATGAGCTTCACCAAGAAAGAGGG - Intergenic
1140374042 16:74430521-74430543 CTAAAGTTCCCCCAGGAAGAAGG - Intergenic
1140807961 16:78551326-78551348 CTGAATTTTCCCAAGAAAGGAGG + Intronic
1140917902 16:79509972-79509994 CTGAGTTTGCCGTAGGAAGCAGG + Intergenic
1141849487 16:86635517-86635539 CAGAGTTTCCCCAGAGAAGACGG + Intergenic
1141983504 16:87564837-87564859 CTGATATTCCCCAAGCAAGAAGG - Intergenic
1144212722 17:13028904-13028926 CTGACTTTCCCAAAGAAAAAAGG - Intergenic
1144270714 17:13612856-13612878 CCCACTTTCCCCAAGGAATAGGG + Intergenic
1144640318 17:16933241-16933263 CCAAGTATTCCCAAGGAAGATGG - Intronic
1146295475 17:31646675-31646697 CTAAGTATTGCCAAGGAAGAAGG + Intergenic
1150829666 17:68508079-68508101 CTGAGGTTCCCTGAGGAAGAAGG + Intergenic
1150853589 17:68729333-68729355 CTGAGTTTTCCCTAGGACGTTGG - Intergenic
1150981115 17:70142602-70142624 CTGTGTTTCCACAGGGTAGAAGG - Intergenic
1151280205 17:73068286-73068308 CGGAGTCTCTCCAAGCAAGATGG - Intronic
1153103279 18:1498511-1498533 CTGAGGTTCCCCAAAGAAAAAGG - Intergenic
1153715431 18:7842640-7842662 CAGAGTTTTCCTAAGGAAGAAGG + Intronic
1154327392 18:13401405-13401427 CTGAGTTTCACCACAGTAGAAGG + Intronic
1156092025 18:33482829-33482851 CTGAGTCATCCCAAGGCAGAAGG + Intergenic
1156788422 18:40943455-40943477 ATGAGTATTTCCAAGGAAGAAGG + Intergenic
1157340513 18:46773723-46773745 CTGAGGTCCCCAAAGGAAGAGGG + Intergenic
1157407014 18:47430242-47430264 CTCAGTTTCCTCATGGAAGAAGG + Intergenic
1157640453 18:49207605-49207627 CTGAGGTTTCCTGAGGAAGAAGG + Intronic
1157860050 18:51133164-51133186 CTCAGTTTCCCCATGGGAGCTGG + Intergenic
1158669975 18:59465793-59465815 CTGTGTTTTCCCAAAGAAAATGG - Intronic
1160875523 19:1294736-1294758 CTCAGTTTCCCCAAAGAGAACGG - Intronic
1161897738 19:7095222-7095244 ATGAGTATTGCCAAGGAAGAAGG - Intergenic
1162135955 19:8555455-8555477 CTGAGCTTCCCCAGGACAGAGGG + Intronic
1163481732 19:17560506-17560528 CTGGGTATCCCCAGGGAAGGCGG + Intronic
1164611619 19:29636433-29636455 CTCAGTTTCCCCATTGAACACGG - Intergenic
1164754942 19:30682301-30682323 ATGTGTTTCCCCAAGAAAGGAGG + Intronic
1164824061 19:31271341-31271363 TTGAGTTTCCACAAGCCAGAGGG - Intergenic
1165188921 19:34045929-34045951 CTGACCTCCCCCAAGCAAGAAGG + Intergenic
1165913839 19:39246058-39246080 CTGAACTTCCCTAAGAAAGACGG - Intergenic
1165917028 19:39266870-39266892 CTGAACTTCCCTAAGAAAGACGG + Intergenic
1165950373 19:39470966-39470988 CTGAGTTTCCCTCTGTAAGATGG + Intronic
1166277608 19:41765644-41765666 CTGAGTTTCCCCAAGACCGATGG + Intronic
1167105071 19:47425447-47425469 CTGAGGTCCCTCCAGGAAGAAGG + Intergenic
1167437419 19:49487468-49487490 CAGAGATTCCCCAGGGAAGGCGG - Intergenic
1168085550 19:54043234-54043256 CTGAGGTCCCCCAAGGTGGAAGG + Intronic
925857873 2:8148127-8148149 CTGACGTGCCCCGAGGAAGAGGG - Intergenic
926056985 2:9779411-9779433 CAGAGTCTCCGGAAGGAAGATGG + Intergenic
926343363 2:11923184-11923206 CTGAGGTTTCCCAAAGAAGATGG - Intergenic
926546986 2:14254684-14254706 TTGAGTTTCAGAAAGGAAGAAGG - Intergenic
926569083 2:14509750-14509772 CTGAGTATTACCAAGGAAGAAGG - Intergenic
926829163 2:16941485-16941507 CTGAGGTCCCCCAAGAAGGAAGG + Intergenic
926937735 2:18103316-18103338 CTGGATTTACCCAAGGGAGAGGG + Intronic
927092295 2:19721295-19721317 CTGACTTCCCCCAAGCAAGAGGG + Intergenic
927444390 2:23144943-23144965 CTGACTTTCCTAAAGGCAGAGGG + Intergenic
927508546 2:23630009-23630031 GGGAGTTTCCAGAAGGAAGAAGG + Intronic
927616080 2:24597656-24597678 CTGAGGTTGCCCAAGGAAAAAGG - Intronic
928084345 2:28336511-28336533 CTGTGTGACCCCAAGGATGATGG + Intronic
928923575 2:36553066-36553088 CTGAGTTTCCAATAGCAAGAAGG + Exonic
929911669 2:46095185-46095207 CTGAGGTTCCCCAACTAAGTGGG - Intronic
930417136 2:51103278-51103300 TTGAGTGTCCTCAGGGAAGAGGG - Intergenic
931964480 2:67518205-67518227 CTGAGTATTGGCAAGGAAGAAGG + Intergenic
932547574 2:72730389-72730411 CTGACTGTGCCCAAGGAAGAGGG + Intronic
934115209 2:88783367-88783389 CTTATTCTCCTCAAGGAAGAGGG + Intergenic
934628249 2:95883713-95883735 ATTACTTTCCTCAAGGAAGAGGG - Intronic
934628370 2:95885587-95885609 ATTATTTTCCACAAGGAAGAGGG - Intronic
934628498 2:95887463-95887485 ATGATTTTTCCCAAGGAAGAGGG - Intronic
934631069 2:95923034-95923056 ATGATTTTCCTCAAGGAAGAGGG - Intronic
934802590 2:97180375-97180397 ATTATTTTCCTCAAGGAAGAGGG + Intronic
934802977 2:97185949-97185971 ATTATTTTCCTCAAGGAAGAGGG + Intronic
934805029 2:97214054-97214076 ATGATTTTTCCCAAGGAAGAGGG + Intronic
934805154 2:97215936-97215958 ATTATTTTCCGCAAGGAAGAGGG + Intronic
934832203 2:97539572-97539594 ATTACTTTCCTCAAGGAAGAGGG - Intronic
934832329 2:97541450-97541472 ATTATTTTCCACAAGGAAGAGGG - Intronic
934832454 2:97543326-97543348 ATGATTTTTCCCAAGGAAGAGGG - Intronic
934833223 2:97554598-97554620 ATTATTTTCCTCAAGGAAGAGGG - Intronic
934833606 2:97560201-97560223 ATTATTTTCCTCAAGGAAGAGGG - Intronic
935368726 2:102322221-102322243 CTGAGGTTTCCCAAAGAAGAAGG - Intronic
935762323 2:106332790-106332812 ATGAGTATTGCCAAGGAAGAAGG - Intergenic
936090668 2:109499540-109499562 TGGAGTTTCCCCAGGGCAGAGGG + Intronic
936348741 2:111696489-111696511 CTGATGTTACCCAAGGAAGAGGG - Intergenic
936433739 2:112485347-112485369 ATGAGTTTCCCCATGGAATGCGG + Intronic
936889283 2:117350287-117350309 CAGAATTGCCTCAAGGAAGATGG + Intergenic
937296532 2:120812917-120812939 CTGTGTGTCCCCACTGAAGAAGG + Intronic
937349082 2:121148711-121148733 CTGAAGTCCCCCAAGGAAGAAGG + Intergenic
937709002 2:124957177-124957199 CTGAGTATCCACAAGCAAAAAGG + Intergenic
937958123 2:127434661-127434683 CTGACTCTACCCAAGAAAGAAGG - Intergenic
938141360 2:128797326-128797348 CTGAGGTTTCCCGAAGAAGAAGG - Intergenic
938409402 2:131051419-131051441 CTGTTTTTCCCCAACAAAGAAGG - Exonic
939067292 2:137498975-137498997 CTGAGTCTCCCTCAGGAAGTGGG + Intronic
940075379 2:149735706-149735728 ATGAGTATCACCAGGGAAGAAGG + Intergenic
940103450 2:150069879-150069901 CTGAGGTTCCCCAGTGAAAATGG - Intergenic
940397212 2:153203551-153203573 GTGATTTTCCCCATGGAAAATGG + Intergenic
941309520 2:163911951-163911973 ATGAGTATTGCCAAGGAAGAAGG - Intergenic
942650861 2:178165994-178166016 CTGACCTTCCCCAAGCAAGAAGG + Intergenic
943244947 2:185434896-185434918 CTGACTTCCCTCAAAGAAGAAGG - Intergenic
943665253 2:190602362-190602384 CTGATATTTCCCAAAGAAGAAGG - Intergenic
944495379 2:200302593-200302615 CTTAGTTTCCACATGGCAGATGG + Intergenic
947906126 2:233764702-233764724 CTGTGTCTCCCCAAGAAAGAGGG + Intronic
948099350 2:235361008-235361030 CTGACTTCCCTCAAGCAAGAAGG + Intergenic
948220463 2:236265449-236265471 CTGACTTTCCCTGAGCAAGAAGG + Intergenic
948821596 2:240552172-240552194 ATGAGTATTGCCAAGGAAGAAGG - Intronic
1169100367 20:2942596-2942618 CTGACCTCCCCCAAGCAAGAGGG + Intronic
1169100460 20:2943407-2943429 CTGACCTTCCCCACGCAAGAGGG - Intronic
1169646697 20:7819030-7819052 TGGAGGTTTCCCAAGGAAGAAGG - Intergenic
1169864102 20:10181615-10181637 CTGAGATGACCCAATGAAGATGG - Intergenic
1169933229 20:10856302-10856324 CTCAATTTTCCCAAGGAAGTAGG + Intergenic
1170025837 20:11889306-11889328 CTGACTTCCCCTAAGCAAGAAGG - Intergenic
1170126365 20:12968781-12968803 CAGAGTTTCCCAAAGGATAATGG - Intergenic
1171954441 20:31449650-31449672 CTGAGTTTCCCCGAGGAGCTAGG - Intronic
1172226629 20:33309726-33309748 CTGGGTTTCCACAAGGAGGCTGG - Exonic
1172993832 20:39055387-39055409 CTGATATTCCTTAAGGAAGAAGG - Intergenic
1174073803 20:47917869-47917891 ATGAGTATTGCCAAGGAAGAAGG - Intergenic
1175751539 20:61501537-61501559 CTGAGATTCAGCAAGGATGAGGG - Intronic
1177380192 21:20330812-20330834 CTGAGTATACCCCAGGAAGAAGG - Intergenic
1178223560 21:30688610-30688632 CTGAGGTCCCCCAAAGAGGAAGG + Intergenic
1178389816 21:32189078-32189100 CTCAGCTTCCTCATGGAAGAGGG + Intergenic
1178472531 21:32906139-32906161 CTGAGGTTTCCTGAGGAAGAAGG + Intergenic
1178473055 21:32911872-32911894 CTGAGGTTTCCCAGGGAAGAAGG - Intergenic
1179139280 21:38709983-38710005 ATGAGTATTTCCAAGGAAGAAGG - Intergenic
1179673313 21:42964776-42964798 CTGAGGTTCCCTAAGAAGGAAGG - Intergenic
1180704084 22:17798074-17798096 CTGCATTTCCCCAGGGAACACGG + Intronic
1181565574 22:23735080-23735102 GGGAATTTGCCCAAGGAAGAAGG + Intergenic
1181999810 22:26911142-26911164 CTGAGTATCCCACAGGAGGAAGG + Intergenic
1182085347 22:27557357-27557379 CTAAGTTCCCCCAAGGCAGAGGG - Intergenic
1182395235 22:30030880-30030902 CTCAGTTTCCTCAATGAAAAAGG - Intergenic
1182435054 22:30325274-30325296 CTGGATTTCTCCAAGGAAGAAGG + Intronic
1182986330 22:34721428-34721450 CTGAGTCTTCACAAGGAAGGGGG + Intergenic
1183026369 22:35068452-35068474 CTGAGTTTTCCAAAGGGAAAGGG + Intronic
1183103672 22:35599503-35599525 CTGAAGTTCCACAAGGAAGAAGG - Intergenic
1183658159 22:39202790-39202812 CTGAGTTTCCTCCAAGATGATGG - Intergenic
949412355 3:3779738-3779760 GTGTATTTCCACAAGGAAGAGGG + Intronic
949459605 3:4276101-4276123 ATAAATTTCCCCAGGGAAGATGG - Intronic
949840276 3:8312592-8312614 CTGAGATTCCCCAAGGAATGTGG - Intergenic
949925878 3:9041248-9041270 CTAAGTTTACCCAGGGAAGCTGG + Intronic
951290030 3:20863709-20863731 TTGAATTTCCCCAAAGAAAATGG + Intergenic
951394713 3:22151595-22151617 CTGACTTTCCTCAAGCAAGAAGG - Intronic
951966180 3:28388101-28388123 CTGACCTGCCCCAAGCAAGAAGG - Intronic
952563163 3:34620222-34620244 CTGAGCTTCCGCAATGAGGAAGG - Intergenic
952719639 3:36519025-36519047 CTGGGATTCCAGAAGGAAGAGGG + Intronic
954329468 3:49881871-49881893 CTGAGGCCCCCCAAGGAGGAAGG + Intergenic
955710003 3:61768775-61768797 GTGTGTTTGCCCAGGGAAGAGGG + Intronic
955722216 3:61894732-61894754 CTGATTCATCCCAAGGAAGAAGG - Intronic
955880749 3:63542360-63542382 CTTAGTATCCCCAACGAAGGGGG - Intronic
955942367 3:64158612-64158634 CTGAGTTTGCCTAAGGGAGAAGG - Intronic
956035690 3:65088838-65088860 CTGAGATTCCCTCAGGAGGAAGG + Intergenic
956254437 3:67268857-67268879 CTGAGGTTCCCTGATGAAGAAGG + Intergenic
957942833 3:87026653-87026675 CTGATTTTTCCTAAGGAAGAAGG - Intergenic
958841080 3:99205992-99206014 CTGACATACCCCAAGGAAAAGGG - Intergenic
959078632 3:101777824-101777846 CTGTATTTCCTCGAGGAAGAAGG + Intergenic
961175189 3:124829691-124829713 CTGTGTTTCCTCAAGGAGGGAGG - Intronic
961697381 3:128714842-128714864 CTGAGTCTTCCCATGGCAGAGGG - Intergenic
961785703 3:129345300-129345322 CTTTGGTTCCACAAGGAAGATGG - Intergenic
961869275 3:129976123-129976145 CTGAGCTTCCGAAAGGCAGAAGG - Intronic
961993062 3:131212999-131213021 CTGATCTTCCCCAAAGAAGAAGG + Intronic
962463219 3:135633763-135633785 CTGAGTTTTCCCAAAGATGAAGG + Intergenic
962654392 3:137528303-137528325 CTGAGGTCCCCCAAAGAAGAAGG + Intergenic
962878705 3:139555886-139555908 ATGAGTGTCCCCAAGGAGAAGGG + Intergenic
964832723 3:160903369-160903391 TTGAGTTTTCCTAGGGAAGAAGG - Intronic
965015878 3:163156023-163156045 CTGAGTATTGCTAAGGAAGAAGG + Intergenic
965319798 3:167239175-167239197 CTGAGGTCCTCCAAGGTAGAGGG - Intergenic
965657827 3:171007738-171007760 CTGAATTTCCACAACGTAGAGGG + Intronic
965804570 3:172528848-172528870 CTGAGCTTCCAGAATGAAGAGGG + Intergenic
969231424 4:5834455-5834477 CTGAGTTATCCCATGGCAGAGGG - Intronic
969964525 4:10980185-10980207 GTGAGTGCCCCCAAGTAAGAAGG - Intergenic
970069804 4:12144827-12144849 ATGACTTTGTCCAAGGAAGATGG + Intergenic
970192693 4:13530626-13530648 CTCATTCTCCCCAAGGAATAAGG - Intergenic
970321475 4:14879670-14879692 CTCAGTCTCCCCAAGGTAGGAGG - Intergenic
970534296 4:17013433-17013455 CTGAGATTCTCCAAGGAAAAAGG + Intergenic
970811589 4:20100458-20100480 CAGAGTCTCCACAAGGAAGCTGG + Intergenic
971223351 4:24729274-24729296 CTGAGATCCTCCAAAGAAGAAGG + Intergenic
972563283 4:40247528-40247550 CTCAGTTTCCTCATGTAAGATGG - Intergenic
972696655 4:41453019-41453041 CTGAGTATCATCAAGTAAGAAGG - Intronic
973841520 4:54865800-54865822 CAGAGTTCCCACAAGCAAGAAGG + Intergenic
974538893 4:63207429-63207451 ATGAGTATTGCCAAGGAAGAAGG + Intergenic
975544406 4:75546751-75546773 CTGAGCTTCCCTGAGTAAGAGGG - Intronic
975850943 4:78571996-78572018 CTGGGATTCCCCAAGGACAATGG + Intronic
976266527 4:83190577-83190599 ATGAGGGTCTCCAAGGAAGAAGG + Intergenic
977083382 4:92562296-92562318 CTGATTTTCCCCAAGGTTAATGG + Intronic
977703050 4:100042309-100042331 CTCAGTTTTCTCAAGGAAGCAGG + Intergenic
977711361 4:100129626-100129648 CTGAGATTCAACAAGGAGGATGG + Intergenic
980432024 4:132713671-132713693 CTGAGTTTCGGCTAGGCAGATGG + Intergenic
983984423 4:174040941-174040963 GTGAATTTTTCCAAGGAAGATGG - Intergenic
983996139 4:174184729-174184751 ATGAGTTCCCCCAAGGAACATGG + Intergenic
984410027 4:179386186-179386208 CTGAGCATCTTCAAGGAAGAGGG - Intergenic
984524178 4:180837108-180837130 CTCACTTTCCCAGAGGAAGATGG - Intergenic
984524339 4:180840063-180840085 CTGAACTTCCCTAAGCAAGAAGG - Intergenic
984816208 4:183839149-183839171 CTGACTTCCTCCAAGGAAGAGGG - Intergenic
985104827 4:186490051-186490073 ATGAGTATTGCCAAGGAAGAAGG - Intronic
985234279 4:187856074-187856096 ATGAGTGTTGCCAAGGAAGAAGG + Intergenic
985271923 4:188201713-188201735 ATGAGTATTGCCAAGGAAGATGG + Intergenic
985290784 4:188384813-188384835 ATGAGTATTGCCAAGGAAGAAGG - Intergenic
985298734 4:188464124-188464146 ATGAGTATTGCCAAGGAAGAAGG - Intergenic
986131016 5:4930220-4930242 CTGAGGTCTCCCAAAGAAGAAGG - Intergenic
986290519 5:6395863-6395885 CTGACCTCCCACAAGGAAGAGGG - Intergenic
986331701 5:6721113-6721135 CTGAGTCTCCTCAGGGAAGGAGG + Intronic
986898002 5:12394394-12394416 CTGATTTCCCCTGAGGAAGAAGG - Intergenic
986901739 5:12443267-12443289 CTAAGATTTCCCAAAGAAGAAGG - Intergenic
987925180 5:24331625-24331647 CTGAGCTTGCCCCAGGAAGAGGG + Intergenic
988363527 5:30266483-30266505 CTGAGGTTCCCCAGGGAAAAAGG - Intergenic
990322584 5:54644502-54644524 TTGAGTTTCTCTTAGGAAGAGGG - Intergenic
990835606 5:60015746-60015768 CTGATGTTCTCAAAGGAAGAGGG + Intronic
991337713 5:65567864-65567886 CTGAGCTTCCCTGAAGAAGAGGG + Intronic
992960318 5:81951545-81951567 CTGACCTTCCCTTAGGAAGAAGG - Intergenic
994413219 5:99436428-99436450 CTCAGCTTCCCCAAGTAAGTGGG + Intergenic
994639650 5:102391256-102391278 CTTAGTCTTCCCAAAGAAGAAGG + Intronic
994876871 5:105435227-105435249 CTAAGGTCTCCCAAGGAAGAGGG - Intergenic
995572280 5:113492682-113492704 CAGAGTTTCCACCAGCAAGAAGG + Intergenic
996176496 5:120365921-120365943 ATGAGTATTGCCAAGGAAGAAGG + Intergenic
996753407 5:126911960-126911982 CTGAGCTTCCCTGTGGAAGAGGG - Intronic
999065064 5:148676614-148676636 CTGGGTTTTCCCAAGTAAAAGGG - Intronic
999277194 5:150339112-150339134 CTGACTCTCCCCCAGGCAGAGGG - Intronic
999297047 5:150466206-150466228 CTGGGTTTCCCCTCGGAGGAAGG - Intergenic
1000540845 5:162538048-162538070 ATGAGTATTGCCAAGGAAGAAGG + Intergenic
1001527555 5:172439577-172439599 TTGAGTTGGCCCAAGGAAGATGG - Intronic
1002905186 6:1442625-1442647 ATGAGTTTTGCCAGGGAAGAAGG - Intergenic
1003270519 6:4603612-4603634 CTGGGTTTGCCCAAGATAGAGGG - Intergenic
1003618587 6:7677225-7677247 CTGAGGTTCCCCGAGGAAGAAGG + Intergenic
1003923751 6:10857486-10857508 CTGAGGTTCCTCAGAGAAGAAGG + Intronic
1003964980 6:11244098-11244120 CTGAGGTTCCCTGAAGAAGAGGG + Intronic
1004244960 6:13965750-13965772 ATGAGTATTGCCAAGGAAGAAGG + Intronic
1005563904 6:27069562-27069584 CTGACTTTGCCAAAGGAAAAGGG + Intergenic
1006015014 6:31073737-31073759 CTGACATCCCCCAAGGAAGAGGG - Intergenic
1006065464 6:31458966-31458988 CTGACCTTCCCCAAGCAAGATGG + Intergenic
1006260546 6:32865571-32865593 CTGAGGTCCTCCAAGGAAGAGGG - Intergenic
1006431464 6:33999973-33999995 CTTATTTTCCCCAAGGCAGAGGG - Intergenic
1007163768 6:39813340-39813362 CTGAGCTGCCCCAAAGAGGAGGG - Intronic
1007540652 6:42640623-42640645 CTGACGTCCCCCATGGAAGAAGG - Intronic
1008712009 6:54238671-54238693 CTGAGATTTCCTAAGCAAGAAGG + Intronic
1008927286 6:56900259-56900281 ATGAGTTTCAGCAAGGAATAGGG - Intronic
1011400777 6:86959134-86959156 CTGAGTTTCCCCAAGGAAGAGGG - Intronic
1012368799 6:98477585-98477607 ATGAGTATTGCCAAGGAAGAAGG - Intergenic
1012956081 6:105571634-105571656 CTGAGATTCCCCAACTAAGCAGG - Intergenic
1013068365 6:106705323-106705345 CTGAGTATTGCCAGGGAAGAAGG + Intergenic
1013989455 6:116236759-116236781 CTTATTTTCCCCAATTAAGAAGG + Intronic
1014604697 6:123458449-123458471 CTGAAGTCCCCCAAGGAGGAAGG + Intronic
1015127871 6:129774598-129774620 GTGAGTTTACCCAAGGAAGGAGG + Intergenic
1015217790 6:130769945-130769967 CTGAGGTTTCCAAAGGAGGAAGG + Intergenic
1015505755 6:133985785-133985807 TTGAAAGTCCCCAAGGAAGATGG - Intronic
1016262121 6:142184718-142184740 CTGAGTGTCCACAATGTAGAGGG + Intronic
1017718041 6:157225587-157225609 CTGAGTTTCCCAGGGGAAGTGGG + Intergenic
1018625795 6:165777534-165777556 CTGAGTTATCCTAAGCAAGATGG + Intronic
1019133706 6:169895504-169895526 CTGAGGTTCCTGGAGGAAGAAGG - Intergenic
1019212378 6:170417203-170417225 ATGAGCTTCACCCAGGAAGAGGG + Intergenic
1019799351 7:3076984-3077006 CTGACATTCCCCAAGGAAAAGGG - Intergenic
1019967624 7:4512926-4512948 CTAAGTTCCCCCAAGAAAGAAGG + Intergenic
1020084919 7:5305125-5305147 CTTAGCTTCCCCAAGGAATGGGG + Exonic
1020105291 7:5419897-5419919 CTGAGAGACCCCAAGGAAGAGGG + Intronic
1020375308 7:7478596-7478618 CTGAGCCTCCCCAAGGAGCACGG - Intronic
1021547151 7:21826784-21826806 GTGAGTTTCTCAAAGGAGGATGG - Intronic
1021586568 7:22214982-22215004 CTAACTTTTCCTAAGGAAGATGG - Intronic
1021604333 7:22395111-22395133 CTGAGTATTGCCAGGGAAGAAGG - Intergenic
1022840524 7:34159694-34159716 CTGACCTTTCCCAAAGAAGAGGG - Intergenic
1022846217 7:34212816-34212838 CTGAATTGGGCCAAGGAAGAGGG - Intergenic
1023009623 7:35914446-35914468 CTGACCTCCCCCAAGGAAGAAGG + Intergenic
1023462424 7:40413380-40413402 CTGACTTTCCCCATTGAAGTAGG - Intronic
1024009596 7:45256525-45256547 CTCAGGTCCCCCGAGGAAGAGGG - Intergenic
1024042490 7:45566151-45566173 CCAACCTTCCCCAAGGAAGAAGG + Intergenic
1024081202 7:45857034-45857056 CTGACCTCCCCCAAGGAAGAAGG - Intergenic
1024654794 7:51442538-51442560 ATGAGTATTGCCAAGGAAGAAGG + Intergenic
1025123303 7:56324717-56324739 CTGACCTCCCCCAAGGAAGAAGG + Intergenic
1025209368 7:57011987-57012009 CTTAGCTTCCCCAAGGAATGGGG - Intergenic
1025220097 7:57100314-57100336 CTGACCTCCCCCAAGCAAGAGGG - Intergenic
1025630877 7:63271894-63271916 CTGACCTCCCCCAAGCAAGAGGG - Intergenic
1025662577 7:63564867-63564889 CTTAGCTTCCCCAAGGAATGGGG + Intergenic
1026204381 7:68243382-68243404 CTGACCTCCCCCAGGGAAGAAGG + Intergenic
1028842841 7:95446963-95446985 CTGACCTTTCCCAAGGGAGAAGG - Intergenic
1029303799 7:99604110-99604132 CTCAGTTTACCAGAGGAAGAGGG + Intronic
1030304128 7:108002541-108002563 CTGGGTTTCCCCACCGCAGAGGG - Intronic
1030999550 7:116398748-116398770 CTGACCTCTCCCAAGGAAGAAGG + Intronic
1032062579 7:128737368-128737390 CTGAGGTTCCCTAATGGAGAAGG - Intergenic
1032275021 7:130446814-130446836 CTGATCTCCTCCAAGGAAGAGGG + Intergenic
1032566935 7:132956098-132956120 CTGAGGTTCTCTAAGGAAGAGGG + Intronic
1032855549 7:135830580-135830602 CTTAATTTCCCCAGGAAAGAAGG + Intergenic
1032875987 7:136038689-136038711 CTGATCTCCCCCAAGAAAGAGGG - Intergenic
1032880418 7:136084121-136084143 CTGATATCCCCCAAGAAAGAGGG - Intergenic
1034261214 7:149757108-149757130 CTGACCTCCCCCAAGGAAGAGGG - Intergenic
1036507972 8:9373030-9373052 ATGAGTATTGCCAAGGAAGAAGG - Intergenic
1036547362 8:9784828-9784850 ATGAGTATTGCCAAGGAAGAAGG + Intergenic
1037102513 8:15064801-15064823 ATGAGTATTGCCAAGGAAGAAGG - Intronic
1037385546 8:18336500-18336522 CTGATGTTCCTCAAGGAAGGTGG - Intergenic
1038349042 8:26760004-26760026 CTGAGAGTCCCCAGGGAGGAAGG + Intronic
1039124274 8:34183488-34183510 ATGAGGTTCCCCAAGAAAGAAGG - Intergenic
1039469622 8:37805135-37805157 CTGGGTTTCCCCAAGCCAAACGG - Intronic
1039910256 8:41820842-41820864 CTGAGCTACACAAAGGAAGAGGG + Intronic
1040396827 8:47008684-47008706 TTCAGTTTCCCCAAGGAAAGTGG + Intergenic
1040957251 8:52992078-52992100 ATGAGTATTGCCAAGGAAGAAGG - Intergenic
1041644336 8:60236211-60236233 CTGAGGTCCCCCAAGGGAGAAGG + Intronic
1041868547 8:62605951-62605973 CACAGTTTTCCTAAGGAAGAGGG + Intronic
1042083995 8:65088374-65088396 GTGAGTTTCCAGAAGCAAGAAGG + Intergenic
1042593003 8:70416165-70416187 CTGAGGTCCCCCAAGAAGGAAGG - Intergenic
1042620056 8:70694569-70694591 CTGAGTCCACCCAAGGCAGAAGG - Intronic
1043003670 8:74791425-74791447 CTGAGGTTCCCCAAAGATGAAGG - Intronic
1044639368 8:94362344-94362366 CTGAGGTTTCCAAAAGAAGAAGG + Intergenic
1046432744 8:114150738-114150760 ATGAGTATTACCAAGGAAGAAGG + Intergenic
1047536155 8:125721632-125721654 CTAAGGTCCCCCTAGGAAGAAGG - Intergenic
1047598375 8:126401666-126401688 CTAAGATTTCCCAAAGAAGACGG - Intergenic
1047722984 8:127659423-127659445 CTGATTTCCCTGAAGGAAGAAGG - Intergenic
1048362322 8:133708484-133708506 CTGTGATTCCCCAAGCTAGAGGG - Intergenic
1050640927 9:7666900-7666922 CTGACCTCCCCCAAGAAAGAGGG + Intergenic
1051829082 9:21255971-21255993 CAGACTTCCCCCAAGGCAGATGG - Intergenic
1054960824 9:70967230-70967252 CTGACTGTCCCCAAGGAACTGGG - Intronic
1056051959 9:82778167-82778189 CTGATTTTCCCAAATGAAAATGG - Intergenic
1056942267 9:90965673-90965695 CTGAGGTTTCCCAAAGGAGAAGG - Intergenic
1057362327 9:94384975-94384997 CTGCGTTATCCCAAGGGAGAAGG - Intronic
1057498979 9:95581871-95581893 CTCAGTTTCCCCACTGGAGATGG + Intergenic
1057528719 9:95825321-95825343 CTGTGCTTCCCCAGGGAAGCAGG - Intergenic
1057570841 9:96203195-96203217 CAGAGTTTCCACCAGCAAGAAGG + Intergenic
1057661014 9:97003125-97003147 CTGCGTTATCCCAAGGGAGAAGG + Intronic
1057820495 9:98326623-98326645 CAGAGTTGCCTCATGGAAGATGG + Intronic
1060871096 9:127040711-127040733 TTGAAGTTGCCCAAGGAAGAAGG + Intronic
1061144926 9:128791960-128791982 CTGACTTTCTTCAAGGAACAGGG - Intronic
1061672921 9:132199100-132199122 CTGAGCTTTTCCACGGAAGAAGG + Intronic
1203582578 Un_KI270746v1:25157-25179 ATTATTTTCCTCAAGGAAGAGGG + Intergenic
1185514374 X:688107-688129 CTGAGTTCCCCCAAGTAACTAGG - Intergenic
1185959108 X:4527789-4527811 CAGTGTTTTCCCAAGGAACAAGG - Intergenic
1186306404 X:8264356-8264378 CTGAGGCTCTCCAAGGAACAAGG + Intergenic
1187476189 X:19613123-19613145 GTGGATGTCCCCAAGGAAGACGG + Intronic
1187588693 X:20692089-20692111 CTGACTTCCCCCAAGAAAGAGGG - Intergenic
1187685317 X:21810269-21810291 CTGTGTCTCCCCATGGCAGAAGG + Intergenic
1187845007 X:23525614-23525636 CTGAGTTTCCCCAGGCCACAGGG - Intergenic
1188182007 X:27067427-27067449 ATGAGTATTGCCAAGGAAGAAGG - Intergenic
1189194640 X:39142531-39142553 CTTAGTTCCCCAAAGGAAAAAGG - Intergenic
1189223284 X:39391242-39391264 CTGAGGTTCCCAGAGGAAGAAGG - Intergenic
1189472723 X:41326815-41326837 CTGAGGTCTCCCTAGGAAGAGGG - Intergenic
1190618064 X:52258653-52258675 CTGATGTTACCCAAGGAAGAGGG + Intergenic
1191081824 X:56520319-56520341 CTGACCTCCCCCAAAGAAGAGGG + Intergenic
1192568688 X:72184471-72184493 CTGAGATTCCCCAAGATAGATGG + Intronic
1193791734 X:85822401-85822423 CAGAGTTTCCCCAAATGAGAAGG + Intergenic
1193849792 X:86522922-86522944 TTGAGTTTCCCAAAAGATGATGG + Intronic
1195343955 X:103929782-103929804 TTGAGTTTCCCCAAGAAACCTGG + Intronic
1195884758 X:109626252-109626274 CTGAGCTTCACAAAGGAAAAGGG + Intronic
1196715294 X:118805211-118805233 ATGAGTATTGCCAAGGAAGAAGG - Intergenic
1196732636 X:118956665-118956687 ATGAGTATTGCCAAGGAAGAAGG + Intergenic
1198662971 X:138990896-138990918 CTGTCTTTTCCCAAGGAAGGGGG - Intronic
1198742749 X:139858096-139858118 CTGAGTTGCCCCATGGCAGAAGG - Intronic
1199279904 X:145989190-145989212 CTGAGGTCCCCAAAGGAAGAAGG - Intergenic
1199486857 X:148357814-148357836 CTGAAGTACCCCAAAGAAGAGGG - Intergenic
1199590715 X:149465877-149465899 CTGAGGTCCCCCAAGAAAGTAGG + Intergenic
1201765536 Y:17570798-17570820 TTGAGTTTCCCTAAGGAGGGAGG + Intergenic
1201836016 Y:18335191-18335213 TTGAGTTTCCCTAAGGAGGGAGG - Intergenic