ID: 1011401972

View in Genome Browser
Species Human (GRCh38)
Location 6:86973158-86973180
Sequence ATTTAAAAGGAGAAGGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 734
Summary {0: 1, 1: 0, 2: 8, 3: 68, 4: 657}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011401972_1011401979 2 Left 1011401972 6:86973158-86973180 CCCTCCACCTTCTCCTTTTAAAT 0: 1
1: 0
2: 8
3: 68
4: 657
Right 1011401979 6:86973183-86973205 TTGGCTTTTAACTCCACTGTAGG No data
1011401972_1011401982 28 Left 1011401972 6:86973158-86973180 CCCTCCACCTTCTCCTTTTAAAT 0: 1
1: 0
2: 8
3: 68
4: 657
Right 1011401982 6:86973209-86973231 TATGCTCCTTGTCTGGAAGCTGG 0: 1
1: 0
2: 0
3: 13
4: 134
1011401972_1011401981 21 Left 1011401972 6:86973158-86973180 CCCTCCACCTTCTCCTTTTAAAT 0: 1
1: 0
2: 8
3: 68
4: 657
Right 1011401981 6:86973202-86973224 TAGGTTCTATGCTCCTTGTCTGG 0: 1
1: 0
2: 0
3: 10
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011401972 Original CRISPR ATTTAAAAGGAGAAGGTGGA GGG (reversed) Intronic
900337940 1:2174071-2174093 TTTTCAAAGGTGCAGGTGGAGGG + Intronic
900877105 1:5350629-5350651 CATTTGAAGGAGAAGGTGGAGGG + Intergenic
901342807 1:8510634-8510656 ATAGAAAAGGACAAGTTGGAAGG - Intronic
901357706 1:8665672-8665694 ATTTAAGTAGAGCAGGTGGAAGG + Intronic
901631500 1:10650337-10650359 GTTTAAAAGGGGATGGGGGAGGG - Intronic
902108602 1:14059048-14059070 ATTTAGAATGAGGAGGTCGAGGG + Intergenic
903762081 1:25705832-25705854 ATTCAAGAGGCTAAGGTGGAAGG + Intronic
903904312 1:26672985-26673007 CTTTGAAGGGAGAAGGTGGGAGG - Intergenic
904216832 1:28927674-28927696 ATTTAAGAGGAGAAGGAGAAAGG - Intronic
904712694 1:32442698-32442720 GTTTAAAAGTAGAAGGTGGCTGG + Intergenic
906465066 1:46071235-46071257 ATTTAAAAGGTGGAGGCTGAAGG - Intronic
906674730 1:47685092-47685114 TTGTAAAAGGAGTAGGTGGGAGG + Intergenic
907700457 1:56781827-56781849 ATTTTAAAGGAGAAAGGGGTTGG - Intronic
907980985 1:59480598-59480620 ATTTAAAAAGAAGAGGAGGAGGG + Intronic
908279159 1:62512427-62512449 ATTTATAAGGAAAAGGAAGATGG + Intronic
909253659 1:73390571-73390593 AGTTAGAAGAAGAAGGAGGAAGG - Intergenic
909377624 1:74958026-74958048 ATTTAAAGGCACAAGGTAGAAGG - Intergenic
909396122 1:75172780-75172802 ATTTCTAAGGAAAAGCTGGAAGG - Intergenic
909830346 1:80181432-80181454 ATTGAAAATCAGAAGGTGAAGGG - Intergenic
910250679 1:85195483-85195505 ATCTAAAAGGAGGAGAGGGATGG + Intronic
910457695 1:87414940-87414962 CTTTGAGAGGCGAAGGTGGATGG + Intergenic
910507606 1:87967959-87967981 AGTTAAAAGGACAAAGTAGACGG + Intergenic
910651999 1:89579432-89579454 ATTTGAGAGGCCAAGGTGGAAGG + Intronic
910655495 1:89614278-89614300 GTTTAAGAGGAACAGGTGGAAGG - Intergenic
911295592 1:96110993-96111015 ATTTGAAAGGAGAAGGTACAAGG + Intergenic
911459296 1:98169364-98169386 ATTTAGATGAAGAAGGTGGTGGG - Intergenic
911584059 1:99669810-99669832 ATTAAAAAGGAGAAGGAGGAGGG + Intronic
911855876 1:102873841-102873863 ATTTAGAAGGAGATGGTTCAGGG - Intergenic
912535393 1:110364820-110364842 TTTTAAAAGCATAAGTTGGAGGG + Intronic
912553559 1:110499999-110500021 ATTTATAAGAAGATGGTGGGAGG - Intergenic
913703042 1:121392288-121392310 AGTAAAAAGGAGGAGGGGGAAGG - Exonic
915269387 1:154742930-154742952 GATTAAAAGGAGAAGCTGGGAGG - Intronic
915438256 1:155925764-155925786 AATGTCAAGGAGAAGGTGGAAGG - Exonic
915919417 1:159963018-159963040 ATTTAGAAGGAGATGGTGGGTGG + Intergenic
917000327 1:170350828-170350850 ATTAAAAAGGAGGAGGAGGAGGG + Intergenic
917106489 1:171497710-171497732 CTTTGAAAGGCGAAGGTGGGAGG - Intronic
917261953 1:173179361-173179383 ATTTAGAAGGTGAAAGTGAAGGG - Intergenic
917318475 1:173754160-173754182 TTTTAACAGGAGAGGCTGGAGGG + Intronic
918285528 1:183051016-183051038 ATTTGAAAGGAGAAGAGGAAAGG - Intronic
918426332 1:184413822-184413844 AGTCAAAAGGAAAAGGAGGAAGG + Intronic
920701936 1:208224511-208224533 ATTTAAAGGGAAAAGGGGGAGGG + Intronic
920756216 1:208736436-208736458 ATTTAGAAGGAGTAGGAAGAAGG + Intergenic
921118846 1:212119265-212119287 ATTTAGGATGAGAAGGGGGAAGG + Intergenic
921639242 1:217532608-217532630 ATAAATAAGGAGAAGGTGGTAGG + Intronic
922023635 1:221730077-221730099 AATTGAAAGGAGAAAGAGGAGGG - Intronic
924262803 1:242249278-242249300 ATTTCATGGCAGAAGGTGGAAGG - Intronic
924907031 1:248466442-248466464 ATTTAAAAATGGCAGGTGGAGGG - Intergenic
1063078252 10:2738510-2738532 TTTTAAAAATAGAAAGTGGAAGG + Intergenic
1063228138 10:4035177-4035199 ATTTAAAAGGGAAAAGTGGGAGG - Intergenic
1065634061 10:27712499-27712521 AGGTAAAAGGAAAAGGTGGGAGG + Intronic
1065984066 10:30931950-30931972 ATTTATAAGGAGAAGGTAGAGGG + Intronic
1066481668 10:35801751-35801773 AATTAAAATAAGAAGGTGAAGGG - Intergenic
1066725435 10:38387652-38387674 ATTTCATGGCAGAAGGTGGAAGG + Intergenic
1067156266 10:43783508-43783530 ATTTAGAAAGAGAAGGTTTATGG - Intergenic
1067179185 10:43972128-43972150 ATCCAAAATGTGAAGGTGGAAGG - Intergenic
1067238855 10:44473472-44473494 ATTTAAAAAGAACAGGTGGGAGG - Intergenic
1067316303 10:45167498-45167520 TTTAAAAAGGTGAAGGAGGAGGG - Intergenic
1068059638 10:52051191-52051213 TTTTAAAAGGAGATGGATGAGGG + Intronic
1068177129 10:53475811-53475833 ATCTGAAAGGAGAAGGGTGAGGG - Intergenic
1068872171 10:61957012-61957034 ATTTAAAAGGCTGAGGTGGGAGG - Intronic
1069126874 10:64646277-64646299 ATGTACAAAGACAAGGTGGAAGG + Intergenic
1069186713 10:65431979-65432001 ATTGACAAGGAGAAGGTAGTTGG + Intergenic
1070713378 10:78699868-78699890 CCTTAAAAGGAGAAGGTCCAAGG - Intergenic
1070976409 10:80609304-80609326 AGGTAAAAGGAGGAGGAGGAAGG - Intronic
1072093446 10:92152495-92152517 GTTTAAAAGGGGAAGGTGGAAGG - Intronic
1072142459 10:92601156-92601178 ATTGAAAAGGAAAAGGTTGAGGG - Intronic
1072473349 10:95734558-95734580 AATTAAACGGAGAAGGGGGAAGG + Intronic
1072742204 10:97916120-97916142 CTTGAAAATGACAAGGTGGAAGG - Intronic
1072748202 10:97957056-97957078 CTTTAAGAGGCCAAGGTGGAAGG - Intronic
1073573336 10:104599318-104599340 ATTCAGAGGGAGCAGGTGGAGGG + Intergenic
1073605819 10:104894770-104894792 ATGGAAAAGGAGAAGGAGGGAGG + Intronic
1073918614 10:108433539-108433561 AATTAAAATGTGAGGGTGGAGGG + Intergenic
1074394937 10:113089737-113089759 GTTTACAAGGAGAGGGTGGAGGG + Intronic
1074732380 10:116392973-116392995 ACTTAAAAAGAGAAAGTTGAGGG + Intergenic
1074775053 10:116761723-116761745 ATCTAAAACGTGAAGGTGGAAGG + Intergenic
1074783773 10:116821029-116821051 AATTTAGAGGAGAAGGTGGAGGG - Intergenic
1074900587 10:117813164-117813186 ATTTCAGAGGCCAAGGTGGAAGG - Intergenic
1075337208 10:121617153-121617175 TTGGAAAAGGAGAAGGAGGAAGG + Intergenic
1076449177 10:130544481-130544503 GTTTAAAAGGAGAAGGTCAAAGG - Intergenic
1078255626 11:9656101-9656123 AAGAAAAAGGAAAAGGTGGAGGG + Intergenic
1078382447 11:10857079-10857101 ATCCAAAAGGAGACTGTGGAAGG - Intronic
1078422313 11:11222794-11222816 ACTTGAAACCAGAAGGTGGAGGG - Intergenic
1078469886 11:11578367-11578389 AGTTAAAAGGAGAAAGTGTGGGG - Intronic
1078795513 11:14588351-14588373 CTCTAACAGGAGTAGGTGGAGGG + Intronic
1079215921 11:18511653-18511675 CTTTAAAAGGAGAAAGTTTATGG - Intronic
1079518782 11:21300321-21300343 ATTACAGAGGAGAAGGAGGAAGG + Intronic
1079649176 11:22905412-22905434 CTTTAAAACAAGAAGATGGAAGG - Intergenic
1080254371 11:30272531-30272553 AATTAAAAGATGCAGGTGGAAGG + Intergenic
1080319992 11:30997123-30997145 ATGTAAAAGGAAAAGCTGTAGGG + Intronic
1080330471 11:31131250-31131272 AATTAAAGGGAGAAGGTGATTGG + Intronic
1080790857 11:35521349-35521371 AATGAGAGGGAGAAGGTGGAAGG - Intronic
1081110910 11:39132059-39132081 GTTTTAAAGGGGATGGTGGAAGG - Intergenic
1081736865 11:45410434-45410456 ACCTAAAGGGAGAAGATGGAGGG - Intergenic
1081837188 11:46165417-46165439 ATTTGAATGGAGCAGGTGAATGG + Intergenic
1081982205 11:47274813-47274835 ATCTCTAAGGAGAAGGGGGAAGG + Exonic
1082177693 11:49080858-49080880 ATTTAAAAGGAGAAGCAGTATGG + Intergenic
1082182216 11:49133480-49133502 AGTAAAAAGGAGCAGGAGGAGGG + Intergenic
1083129476 11:60611003-60611025 ACTTAGGAGGGGAAGGTGGAAGG + Intergenic
1083181031 11:60985479-60985501 TTATAAAAGGAGAGGGTGGCCGG - Intronic
1083513871 11:63237454-63237476 ATCTCACAGCAGAAGGTGGAAGG - Intronic
1084374628 11:68767916-68767938 ATTTAAAAGGAAAAGCAGGCAGG - Intronic
1086460781 11:87003556-87003578 CTTTGAAAGGCCAAGGTGGAAGG - Intergenic
1086532638 11:87803796-87803818 CGTGAAAAGGAGAAGATGGAAGG + Intergenic
1086536164 11:87849315-87849337 GTTTAAAAGTAGAAGGATGAGGG - Intergenic
1086683290 11:89701466-89701488 AGTAAAAAGGAGCAGGAGGAGGG - Intergenic
1086688028 11:89755018-89755040 ATTTAAAAGGAGAAGCAGTATGG - Intergenic
1086717821 11:90084883-90084905 ATTTAAAAGGAGAAGCAGTATGG + Intergenic
1086920943 11:92585952-92585974 ATGTGAAGGGAGAAGGTGGCTGG + Intronic
1087573132 11:99956022-99956044 ATTTAAATGGTGCAGGTAGAAGG + Intronic
1087642579 11:100771365-100771387 CTTTAAAAGGTGGGGGTGGAGGG - Intronic
1087859283 11:103133556-103133578 ATTCAAAAGCAGGAAGTGGAGGG + Exonic
1088038985 11:105353415-105353437 ACTTAAAAGGAAAAGGCGAATGG - Intergenic
1088163003 11:106896416-106896438 ATTTAAAAGGAGTAGTGAGATGG - Intronic
1088246127 11:107820010-107820032 ATTTAAGAGGCCAAGGCGGATGG + Intronic
1088878516 11:113955748-113955770 ATTTAAAAGAAAGAGGTGAAGGG - Intergenic
1088989150 11:114936542-114936564 ATTTTAAATGAGAAAGTAGAAGG + Intergenic
1089321519 11:117629751-117629773 CTTTAAGAGGCCAAGGTGGAAGG + Intronic
1089548660 11:119252190-119252212 ATGTAAATGGAGTAGGGGGAGGG - Intronic
1090143232 11:124289004-124289026 ATTCAGAAGGCTAAGGTGGAAGG - Intergenic
1090484782 11:127103401-127103423 ATTTAAAAAAAGAAAGTGAAGGG + Intergenic
1090609783 11:128460557-128460579 AGTTGAAAGGATAAGGAGGAGGG - Exonic
1092037738 12:5353557-5353579 ATATAAAATGAGCAGGAGGAAGG + Intergenic
1093209981 12:16296900-16296922 ATTTTAAATGAGAAAGGGGAAGG - Intergenic
1093310002 12:17568387-17568409 AATTAAAAAGAGAATATGGAAGG + Intergenic
1093396523 12:18690059-18690081 ATTGAGAAAGTGAAGGTGGAAGG - Intronic
1093417189 12:18933449-18933471 CTTTAAAAGGGTAAGGCGGAGGG - Intergenic
1094153731 12:27314841-27314863 TTTTAAAAGTAGAAAATGGAGGG - Intronic
1094188263 12:27668385-27668407 ATTAAAAAGGGGGAGCTGGAAGG + Intronic
1094477273 12:30850881-30850903 CATTAAAAGGATAAGGTGGGAGG + Intergenic
1095798363 12:46245889-46245911 ATTAAAAAAGAGAAGGAAGAGGG - Intronic
1097085498 12:56465135-56465157 GTATAAAAGGAGAGGGTGGTTGG - Intronic
1097444510 12:59651863-59651885 ATTTAAAAGAAGATAGTAGATGG + Intronic
1097605474 12:61747923-61747945 ATTTAAAATTAAAATGTGGAAGG + Intronic
1099791848 12:87345650-87345672 AAATAATAGGAGAAAGTGGAGGG + Intergenic
1100030087 12:90176222-90176244 ATTTAAATGGAAAAAGTAGAAGG - Intergenic
1100121954 12:91378912-91378934 ATTGAAAATAAGAATGTGGAGGG - Intergenic
1100589116 12:96008501-96008523 ATTTAAAAGGAAAAGAAGAAAGG + Intronic
1100811320 12:98341303-98341325 ATTTAAAGGGATAAGGAGGAAGG + Intergenic
1101255841 12:102975721-102975743 ATTTAAGAGGCGAAGGTCCAGGG - Intergenic
1101840113 12:108322009-108322031 GTTTAAAAGGAAGAGGTTGAGGG + Intronic
1102418640 12:112786531-112786553 CTCTTAAAGGAGAAGGAGGAGGG + Intronic
1102437615 12:112937702-112937724 ATTTTGGAGGAGAAGGAGGAAGG - Intergenic
1102538833 12:113603289-113603311 AATAATTAGGAGAAGGTGGAAGG - Intergenic
1102684525 12:114714340-114714362 ATTTAAGAGGCCAAGGTGGGAGG - Intergenic
1102691498 12:114764924-114764946 ATTTAAAAGGAAAATGGGGCTGG + Intergenic
1103164247 12:118756673-118756695 AGTTAATTGGAGAAGATGGATGG - Intergenic
1103277390 12:119723992-119724014 CTTAAAAAAGAGAAGGTGGCCGG + Intronic
1103974227 12:124691728-124691750 CTTTAAAAGGTGAAAGTGGGTGG - Intergenic
1104116611 12:125755092-125755114 ATCAAAAAGGAGAATGTAGAAGG - Intergenic
1104785978 12:131448243-131448265 TTTTAAAAGGAGAAATTGTAGGG + Intergenic
1104829461 12:131739889-131739911 ACTCAAAAGGAGAAGCTGTAGGG - Intronic
1105389564 13:19962001-19962023 ATTTAAAAGGATAGGTGGGAGGG - Intronic
1105716355 13:23069099-23069121 TTTAAAAAGAACAAGGTGGAGGG + Intergenic
1105985858 13:25566522-25566544 ATGGAAAAGGAGAAAGTGGCAGG + Intronic
1106970401 13:35134050-35134072 AGTTCAAAAGAGAATGTGGAAGG + Intronic
1107317699 13:39151262-39151284 ATGTAAAAGGGAAAGGTGGGGGG + Intergenic
1107659840 13:42627367-42627389 ATTTAATAAGAGAAGGAGGGAGG + Intergenic
1109019458 13:57068676-57068698 ACTGAAAAGAAGAAGGTGAATGG + Intergenic
1110375013 13:74783512-74783534 CTTTGAAAGGCCAAGGTGGAAGG + Intergenic
1110393827 13:75007111-75007133 AAATAAAAGGAGAAGGAGAAAGG - Intergenic
1110835289 13:80075562-80075584 CTTTAAAAGGCCAAGGTGGGTGG - Intergenic
1111173418 13:84560558-84560580 ACTTAGAAGGCTAAGGTGGAGGG + Intergenic
1111456681 13:88493491-88493513 AATTAAATGGAGAAGGCTGAAGG - Intergenic
1111473278 13:88714085-88714107 TTTAAAAAGGAAAAGATGGAGGG + Intergenic
1111598521 13:90441991-90442013 GTGTGAAAGGAGAAGGAGGAGGG - Intergenic
1112221784 13:97498424-97498446 AATAGAAAGGAGAAGGAGGATGG - Intergenic
1113291995 13:108917325-108917347 ATTTAACAGGAGGAAGGGGAAGG + Intronic
1113456966 13:110456194-110456216 GTTTACAAGGGGAAGGTGGTGGG + Intronic
1114962245 14:27908061-27908083 AATTGAATGGAGAAGCTGGAGGG + Intergenic
1115505316 14:34088170-34088192 ATTAGTAAGGAGAAGATGGAAGG + Intronic
1116386976 14:44343248-44343270 ATTGAAAAGGATAAGGTGAGGGG + Intergenic
1116509643 14:45727959-45727981 TTTTAAAAGAAGATGCTGGATGG - Intergenic
1116794635 14:49376549-49376571 AGTTCAATGGAGAGGGTGGAGGG - Intergenic
1117299748 14:54412968-54412990 GTTTAAGAGGAGAAGTTGGCTGG - Intronic
1117399833 14:55348786-55348808 ATTTAAAAGTTGAAGGTGAAAGG + Intronic
1117601530 14:57380906-57380928 ACTTGAAAGGCTAAGGTGGAAGG + Intergenic
1117647525 14:57867023-57867045 AATGAAAAGGTGGAGGTGGAGGG + Intronic
1118667026 14:68081448-68081470 ATTTAAAAGGAGAAGAGTGAGGG + Intronic
1118668454 14:68096482-68096504 ATCGAAAAGGAGTAGGAGGAAGG - Intronic
1118778914 14:68993090-68993112 ATTAAAAAGGAAAAGGTGGCTGG + Intergenic
1119038252 14:71248795-71248817 CTTTCAAAGGAGGAGGAGGAGGG - Intergenic
1119416051 14:74470160-74470182 TTTTAAAAAGGGAAGGTAGAAGG - Intergenic
1119613681 14:76084274-76084296 ATCTAAAAGGATAAGGAGAAGGG - Intronic
1120097910 14:80409830-80409852 GTTTAAGAGGAAAAGGAGGAAGG - Intergenic
1120686450 14:87543369-87543391 ATTTAAAAGGAGAAGGCTGTGGG + Intergenic
1120717216 14:87852794-87852816 GTATAAAAGGAGAAGGGGCAAGG - Intronic
1120890808 14:89489408-89489430 ATTTAAAAGGAGAATCTCAAGGG - Intronic
1121080403 14:91103335-91103357 GGCTAAAAGGAGAAGGGGGAAGG - Intronic
1121880853 14:97499256-97499278 ATTTAGAAGAAGAAGGAAGAAGG + Intergenic
1123451728 15:20369563-20369585 ATTTAAAAGGAGAAGGTGTGAGG - Intergenic
1124996500 15:34728068-34728090 ATTTAGATGGAGAATGGGGAGGG - Intergenic
1125030999 15:35076026-35076048 ATTGAGATGGAGAAGATGGATGG - Intergenic
1125047719 15:35261722-35261744 ACTTGAGAGGCGAAGGTGGAAGG + Intronic
1125537257 15:40448813-40448835 AGTTAAAAGGAGATGCTGGGTGG - Intronic
1126103077 15:45131013-45131035 ATTTAATAGGAGATGGAGTAGGG + Intronic
1126164807 15:45645829-45645851 ATTTAACTGGAGGAGGTGAAAGG - Intronic
1126752442 15:51890784-51890806 CTTAAAAATGAGAAGGGGGATGG - Intronic
1126820401 15:52497458-52497480 ATTTAAAAGAAGAAATTGGCTGG + Intronic
1127132068 15:55876999-55877021 TTTTAAAATGAGAAGTTGGCTGG - Intronic
1127245725 15:57171945-57171967 GTTTAAATGTAGAAGGTGGCAGG + Intronic
1127362120 15:58253133-58253155 ATAAAAAAGGACAAGATGGAAGG + Intronic
1127505412 15:59593319-59593341 ATTTAAGAGGCCAAGGTGGGAGG + Intergenic
1127512019 15:59651925-59651947 CTTTAGGAGGACAAGGTGGAAGG - Intronic
1127704302 15:61532076-61532098 ATTTTAAAGGAAAAGTTGGCAGG - Intergenic
1128557470 15:68641485-68641507 AGGGAAAAGGAGAAGGGGGAGGG + Intronic
1128856135 15:71018045-71018067 CTGTAAAAGGAGGAGGAGGAGGG + Intronic
1129346288 15:74921942-74921964 ATTTGGAAGGCCAAGGTGGAAGG + Intronic
1129361144 15:75025155-75025177 ATTTAAGAGGGCAAGGTGGGAGG - Intronic
1129651809 15:77496439-77496461 ATGGAAAAGGAGAAACTGGATGG - Intergenic
1130052802 15:80497873-80497895 AATTTAAGGGAGAAGGGGGAAGG + Intronic
1130603138 15:85291642-85291664 ATATAACTGGAGAAGGAGGAGGG + Intergenic
1130838477 15:87674834-87674856 ATTTAAGAGGCTAAGGTGGGAGG - Intergenic
1131636408 15:94237352-94237374 ATTTGAGAGGTGGAGGTGGAAGG + Intronic
1131648122 15:94367824-94367846 GTTTTAAAAGAGAAGGTGGGAGG - Intronic
1131970078 15:97882921-97882943 ATTTAAGAGAAGGAGATGGATGG - Intergenic
1132451354 15:101970348-101970370 ATATAAATACAGAAGGTGGAGGG - Intergenic
1132712358 16:1274845-1274867 ATTTAAAAGGTATTGGTGGATGG - Intergenic
1133571947 16:7049691-7049713 ATTAAAAAGCAGCAAGTGGAGGG - Intronic
1133598833 16:7319433-7319455 ATTTAAAAAGAAGACGTGGAGGG + Intronic
1133652883 16:7829601-7829623 CTTTAAAAGAGGAAGGTGGGTGG - Intergenic
1133849781 16:9491614-9491636 ATTTGCAAGGAGACTGTGGAGGG + Intergenic
1134772957 16:16826510-16826532 AATTAAAAGGAGAAAGAGGGTGG - Intergenic
1135229192 16:20689706-20689728 AAGTAAAAGGAGGAGGTGAATGG - Intronic
1135260714 16:20978231-20978253 TTTTAAAGGGACAAGGTGGCCGG + Intronic
1135269140 16:21053864-21053886 TTTTTAAAGGAGGAGCTGGAAGG + Intronic
1135935836 16:26779266-26779288 GTTTAAAAAAAGAAGGTGGGGGG + Intergenic
1136004904 16:27322729-27322751 ATTAGAAGAGAGAAGGTGGATGG - Intronic
1136546192 16:30956468-30956490 AAGTAATAGGAAAAGGTGGAAGG - Intergenic
1136698697 16:32111952-32111974 AGTAAAAAGGAGGAGGGGGAAGG - Intergenic
1136768907 16:32815877-32815899 AGTAAAAAGGAGGAGGGGGAAGG + Intergenic
1137757437 16:50913864-50913886 CTTTAAAATGAGAAGGTGGAGGG + Intergenic
1138542761 16:57698441-57698463 CTTTAGAAGGAAAAGGTGGGAGG + Intronic
1138625054 16:58244896-58244918 AGTTAAAAGTAGAGGCTGGAGGG - Intronic
1138913905 16:61439401-61439423 ATGTAAAAAGAGATGGAGGATGG + Intergenic
1139304884 16:65976767-65976789 AAATGAAAGGAAAAGGTGGAAGG - Intergenic
1139697662 16:68686532-68686554 ATTCTAAAGGAAAGGGTGGAGGG + Intronic
1139848829 16:69938749-69938771 CTCTAAAAGCAGAACGTGGATGG + Intronic
1140755276 16:78060858-78060880 TTTTAAAAGGAAAAGCTGGCCGG - Intronic
1141363335 16:83418032-83418054 ATTAAAAAGGAGAAAGTGTCTGG - Intronic
1142018839 16:87767184-87767206 ATTTTAAATGGGAAGGTGGAAGG - Intergenic
1142152007 16:88516795-88516817 TTGTAGAAGGAGAAGGGGGAGGG + Intronic
1203071324 16_KI270728v1_random:1077988-1078010 AGTAAAAAGGAGGAGGGGGAAGG + Intergenic
1142760150 17:2037229-2037251 ATATAATTGGAGAAGATGGATGG + Intronic
1144693690 17:17286711-17286733 ATAGAAATGGAGAATGTGGAAGG - Intergenic
1145692850 17:26762202-26762224 AGTAAAAAGGAGGAGGGGGAAGG - Intergenic
1146131106 17:30276021-30276043 ATTTAAAAAAAAAAGGTGAAGGG - Intronic
1146433975 17:32825534-32825556 ATTTGAGAGGCGAAGGTGGATGG - Intronic
1146438240 17:32871438-32871460 ATTAAAAAAGAGAAGTTGCATGG + Intronic
1146451275 17:32976047-32976069 CTTTAAGAGGCTAAGGTGGAAGG - Intronic
1147195360 17:38762921-38762943 AAGTAAAAGGACAAGGAGGATGG - Intronic
1148244722 17:46023132-46023154 ATTGCAAAGGAAAATGTGGAAGG - Intronic
1148540314 17:48475079-48475101 TTTTTAAAGAAAAAGGTGGAGGG - Intergenic
1149103051 17:52928834-52928856 AATTAGGAGGAGAAGGAGGATGG + Intergenic
1149151886 17:53575305-53575327 ATTTGAAAGGCTAAAGTGGAAGG - Intergenic
1149417542 17:56475580-56475602 ATTTAAAAGGGTAAGGTAAAGGG - Intronic
1149772152 17:59331153-59331175 ATTTAAAATGATAGGGGGGAGGG - Intergenic
1149901213 17:60481149-60481171 ATTAAAAAGTAGGAGTTGGAGGG - Intronic
1150978493 17:70115766-70115788 ATTTAAAACAAGGAGGTGGGAGG - Intronic
1150979236 17:70122998-70123020 ATTTAAGAGCAGAAGGAGGGAGG - Intronic
1151099356 17:71538984-71539006 ATTTTTAAGGAGGAGATGGAGGG - Intergenic
1151211952 17:72550983-72551005 ATGTAAAAGGAGAAGTCGGCCGG - Intergenic
1151541620 17:74767652-74767674 CCTTGAAAGAAGAAGGTGGATGG - Intronic
1151664718 17:75539164-75539186 ACTCAAAAGGCTAAGGTGGAAGG - Intronic
1152072236 17:78139591-78139613 TTTTAAAAGGAGAATGTGGCCGG + Intronic
1152460684 17:80440747-80440769 AATCAAAAGGAGAAGCTGGTGGG - Intergenic
1153623365 18:7000648-7000670 ATTTAAAACGTGAAGGCAGAGGG - Intronic
1153798091 18:8643205-8643227 ATATAAGAGGACAAGTTGGAGGG - Intergenic
1153883867 18:9445868-9445890 TTTTAAAAGGAGAACATGGCAGG + Intergenic
1153915038 18:9737865-9737887 TTTTAAAAGCAGAAGGGGGTGGG - Intronic
1154247659 18:12713992-12714014 ATTTGAAAGGCCAAGGTGGGTGG - Intronic
1155492332 18:26411540-26411562 CTTTGAAAGGCCAAGGTGGAAGG - Intergenic
1156412311 18:36842498-36842520 ATCTCAAAGCAGAGGGTGGAAGG + Intronic
1156555114 18:38058955-38058977 ATTTAAAAGGAGAAGAAACATGG + Intergenic
1156585644 18:38428073-38428095 AGGGAAAAGGAGAAGGAGGAAGG + Intergenic
1156603715 18:38640634-38640656 AATTTAAAGGTGAAGGTAGAGGG + Intergenic
1156980135 18:43277113-43277135 ATTTAAAAGGAAAATGAGAATGG - Intronic
1157743107 18:50110571-50110593 ATTTAAGAGGAGAGGCAGGAGGG - Intronic
1157967467 18:52224383-52224405 ATCTCATAGCAGAAGGTGGAAGG - Intergenic
1158705007 18:59784424-59784446 GTTTTAAAGGGGAAAGTGGATGG + Intergenic
1158920084 18:62182020-62182042 ATTAAAAAGGAGAAGGCAGCCGG - Intronic
1159317014 18:66788525-66788547 TTTTAAAAGGGGAATGAGGAAGG - Intergenic
1159346003 18:67205047-67205069 ATTTTAAAGGATAAAATGGAAGG - Intergenic
1160203056 18:76810894-76810916 ATAGCTAAGGAGAAGGTGGAAGG - Intronic
1161131869 19:2595009-2595031 ATTTGAAAGGATGAGGTGGGAGG + Intronic
1161497059 19:4592429-4592451 ATTTAAAAAGAGAAAATGAAGGG + Intergenic
1161537693 19:4830460-4830482 TTTAAAAAGGACAAGGTGGGAGG - Intronic
1161673089 19:5625065-5625087 AATGAAAAGGAGAAGGAAGAAGG - Intronic
1162454541 19:10775493-10775515 ATTGAAATGGAGTAGGTAGAAGG + Intronic
1163361856 19:16851741-16851763 TTTGAAAAGGAGGAGGAGGAAGG + Intronic
1164794771 19:31016907-31016929 ATTTCCAAGGAGAAGCTGGCTGG - Intergenic
1164966190 19:32486893-32486915 ATTTAAAAGGAAAGGAGGGAGGG + Intergenic
1165810213 19:38607573-38607595 AAAAAAAAGAAGAAGGTGGAAGG + Intronic
1165913541 19:39244331-39244353 ATGGAGAAGGAGAAGGTGAAGGG + Intronic
1166401745 19:42486548-42486570 ATTTGAAAGGCCAAGGTGGGAGG - Intergenic
1166413682 19:42576187-42576209 TTTTGAAAGGCCAAGGTGGAAGG + Intergenic
1167196829 19:48034919-48034941 CTTTGGAAGGACAAGGTGGAAGG - Intronic
1167298046 19:48663363-48663385 ATTTAAGATGAGAAAGTGGAAGG + Intronic
1168240720 19:55087567-55087589 AAGCAAAAGAAGAAGGTGGAAGG + Exonic
1168564014 19:57407658-57407680 CTTTGAAAGGTGGAGGTGGAAGG - Intronic
926028999 2:9569269-9569291 ACTCAAAAGGAGCAGCTGGAAGG + Intergenic
926485246 2:13446729-13446751 ATTTAAAAGGAGAAGATGTGAGG + Intergenic
926643478 2:15263247-15263269 ATTTAAAAGGCTGAGGTGGGAGG - Intronic
926778314 2:16444113-16444135 ATTTAAAAGAGCAAGGAGGAAGG - Intergenic
926939131 2:18116577-18116599 ATTTGAAAGGAGGTGGTAGAGGG - Intronic
927583556 2:24278172-24278194 ATTTTAAAGGACAAGTTGGAGGG - Intronic
927955812 2:27206648-27206670 ATTTGAGAGGAGAAGGAAGAGGG - Intronic
928603652 2:32924738-32924760 ATTTAAAAAGAGAAAGAGAAAGG + Intergenic
928657279 2:33465399-33465421 ACATAAAAGTACAAGGTGGAAGG + Intronic
928929260 2:36607146-36607168 ATCTCAAGGCAGAAGGTGGAAGG + Intronic
928945076 2:36764875-36764897 ATGTCAAAGGGGAAGGTGGATGG + Intronic
929199898 2:39223892-39223914 ATTAAAAAAGAGAAGGAGGCTGG - Intronic
929216706 2:39421838-39421860 ATTTAAATGGATAAAGTGGAAGG - Intronic
929259219 2:39845733-39845755 CTTGAAAAGGAAAATGTGGAGGG + Intergenic
930256112 2:49093838-49093860 ATTTGGAAGGCCAAGGTGGATGG - Intronic
930364409 2:50421324-50421346 ATTTAGAAAGTGAAGGGGGAAGG - Intronic
930389337 2:50740759-50740781 AGTTAAAAGGACAAGGAGGAAGG + Intronic
930632552 2:53769544-53769566 CTTTAAAAGGAGAAAGGGGCTGG + Intronic
930733245 2:54748804-54748826 TTTTAAAAGGCCAAGGTGGGAGG - Intronic
931161116 2:59691600-59691622 GGTTAAAAGGGGATGGTGGAAGG + Intergenic
931182395 2:59915891-59915913 CTCTAAAAGGAGACTGTGGAGGG - Intergenic
932018037 2:68053109-68053131 TTTTAGAAGGAGTATGTGGAAGG - Intronic
933056846 2:77681125-77681147 ATTTCAAAGGAGGTGGTGGAGGG - Intergenic
933197860 2:79412780-79412802 ATTGAGAAGGAGAAACTGGATGG + Intronic
933789208 2:85870422-85870444 ATGAAAAAGGAGAACGAGGAGGG - Intronic
933926979 2:87102269-87102291 ATTTCAAAGGAGGTGGTGGAGGG - Intergenic
934500017 2:94851742-94851764 ATTGAAAAGGAGAACTTTGAAGG + Intergenic
934582224 2:95452202-95452224 ATTTAAAAGGAGAAGCGGTATGG - Intergenic
934583809 2:95470743-95470765 CTTTAAAAGGAGACTGTGGATGG - Intergenic
934591500 2:95554982-95555004 ATTTAAAAGGAGAAGCAGAGCGG + Intergenic
934595643 2:95605971-95605993 CTTTAAAAGGAGACTGTGGATGG + Intergenic
934597226 2:95624512-95624534 ATTTAAAAGGAGAAGCGGTATGG + Intergenic
934787133 2:97019509-97019531 TTTTAAAAGGAGACTGTGGATGG - Intergenic
934842659 2:97638483-97638505 ATTTAAAAGGAGAAGCGGTATGG - Intergenic
935137886 2:100322808-100322830 ATTTTAACAGAGAACGTGGAGGG + Intergenic
935461076 2:103335019-103335041 TATTAAAAGGCTAAGGTGGAAGG - Intergenic
936401944 2:112171316-112171338 AGTCAAATGGAGAAGGAGGAGGG + Intronic
936600684 2:113890885-113890907 AGTCGAAAGGAGAAGGTGGGTGG - Intronic
936771070 2:115914371-115914393 ATTTAAAAACAAAAGGTGGGTGG - Intergenic
937058879 2:118966843-118966865 ATTTAACACGAGGTGGTGGATGG - Intronic
937887962 2:126913235-126913257 ATGAAAAAGGAGAAGGATGATGG - Intergenic
938154502 2:128921411-128921433 AAAGAAAAGGAGAAGGAGGAAGG - Intergenic
938236406 2:129709945-129709967 TTGAAAAAGGAGAAGGTGAAAGG - Intergenic
938926833 2:136051072-136051094 TTTAAAAAGGAGAAGGAAGATGG - Intergenic
938964704 2:136377949-136377971 TTTTAAAATCAGTAGGTGGAAGG + Intergenic
939169450 2:138677505-138677527 AATTAAATGAAGCAGGTGGAAGG + Intronic
939342759 2:140920749-140920771 CTTTAAAAGGAAAAAGTGAAAGG - Intronic
939370600 2:141294629-141294651 ATTTAAAAGGCTGAGGTGGGGGG + Intronic
939875878 2:147577323-147577345 ATTTAAAAGGAGAGGGGCTATGG + Intergenic
940037794 2:149329504-149329526 AAATCCAAGGAGAAGGTGGAGGG + Intergenic
940137219 2:150451603-150451625 AAATAGAAGGAGAAGGAGGAGGG - Intergenic
941194496 2:162431799-162431821 ATTTAAAAGGAAAAAAAGGAAGG + Intronic
941650100 2:168083214-168083236 AAAAAAAAGGAGAATGTGGAAGG - Intronic
942198674 2:173549096-173549118 CTTTAAAAGGATTTGGTGGAAGG + Intergenic
942326738 2:174782354-174782376 ACTTCTAAGGAGATGGTGGAAGG - Intergenic
942442975 2:176055225-176055247 CTTTAAAAAGAGAAGGTGGCAGG - Intergenic
942968009 2:181920938-181920960 ATTTAAATGGTTGAGGTGGAAGG + Intronic
943007922 2:182409144-182409166 ATGTAAAAGGAGAAGGGAGGAGG - Intronic
943150470 2:184106242-184106264 AATTAATAGGAAAAGGTAGAGGG + Intergenic
943573532 2:189602882-189602904 ATTTGAAAGGAGAAGGAGGTTGG - Intergenic
943902673 2:193461000-193461022 ATTTAAAAGGAGAATAGGGTGGG + Intergenic
944213883 2:197234603-197234625 ATTAAAAAGAATGAGGTGGATGG - Intronic
944343259 2:198629666-198629688 ATAGAAATGGAGAAAGTGGACGG - Intergenic
945719230 2:213397974-213397996 ATTAAGAAGGAGAACATGGAAGG - Intronic
945814979 2:214593701-214593723 TTTTAAAAGGAGAATGAGGAAGG + Intergenic
945838373 2:214858986-214859008 ATTTAAAAGGAGAGGGGAGAAGG - Intergenic
945945050 2:215987582-215987604 TTTTAAAAGAAGAAAGTGGAAGG + Intronic
946245495 2:218384964-218384986 CTTTAAAAGGCTAAGGTGGGAGG - Intronic
946278802 2:218651223-218651245 ATTTGAGAGGCCAAGGTGGATGG - Intronic
946756029 2:222948642-222948664 ATTTAACAGGAGGAGGAGAAAGG - Intergenic
947378129 2:229518077-229518099 ATCTCAAAGCAGAAGCTGGATGG + Intronic
947621033 2:231591232-231591254 CTTTAAAAGGCCAAGGTGGGAGG - Intergenic
947920462 2:233866915-233866937 CTTTGTAAGGAGATGGTGGATGG - Intergenic
947929652 2:233953016-233953038 ATTTTGAAGGAGAGGGTGGGTGG - Intronic
948096212 2:235336060-235336082 AGAGAAAAGGAGAAGGAGGAGGG - Intergenic
948260470 2:236600677-236600699 ACATAAAAGGAGATGGAGGAAGG + Intergenic
1169668924 20:8072711-8072733 TTTTAAAAGTAGAAGAAGGAGGG + Intergenic
1169746267 20:8946179-8946201 ATTTAAAAAGAGTAGTTGAAGGG - Intronic
1170593071 20:17786078-17786100 ATTTGAAAGGATAAGGGGAAAGG - Intergenic
1170982787 20:21230364-21230386 ATTTAAGAGGCTAAGGTGGGAGG + Intronic
1171121911 20:22575856-22575878 AGGTAAAAGGAGATGGGGGATGG - Intergenic
1171354061 20:24530103-24530125 ATTTTTAAGGATAATGTGGAGGG - Intronic
1171792100 20:29536675-29536697 ATTAAAGAGAAGAAGGTGAAAGG + Intergenic
1172136037 20:32687496-32687518 ATTTAAAAAAAGGAGGTGGTGGG + Intergenic
1172409524 20:34710969-34710991 AGTTAGAGGGAGAAGATGGAGGG + Exonic
1172566535 20:35934932-35934954 AATTAAATGAAGTAGGTGGATGG + Intronic
1172675113 20:36664315-36664337 ATTTAAAAATAGAAGGATGAGGG - Intronic
1172694680 20:36814378-36814400 ATTTAGAAGGACAAGCTGCAAGG + Intronic
1172747610 20:37224824-37224846 ATTTAAAAGGAGTAGCTGCTTGG - Intronic
1172832863 20:37851054-37851076 ATTTAAAATGAGTAAGTGGCTGG + Intronic
1173258313 20:41410921-41410943 AGACAAAAGGAGAAGGTGGGAGG + Intronic
1173782442 20:45767729-45767751 AATAAAAAGGAGAAGGAGGAAGG + Intronic
1174120193 20:48259303-48259325 ACTTGAAAGGTGAAGGTGGTGGG - Intergenic
1175071302 20:56336209-56336231 CTTTAAAAGGCCAAGGTGGGTGG + Intergenic
1175164261 20:57031791-57031813 ATTTAAAAAGAGAAAAAGGAAGG - Intergenic
1175432911 20:58919548-58919570 ATTTAGAAGGCAAAGGTGGTAGG + Intergenic
1175603758 20:60295979-60296001 ATTTAAAATGGGAAGTTTGAGGG + Intergenic
1175654012 20:60753105-60753127 TTTGAAAAGGAGAAGGAGGAAGG - Intergenic
1176370278 21:6058249-6058271 TTCTAAAAAGAGAAGGTTGAGGG - Intergenic
1176918049 21:14649524-14649546 CTTTGAAAGGCCAAGGTGGATGG + Intronic
1177381167 21:20346357-20346379 AATGAAAAGCAGAATGTGGATGG - Intergenic
1177656816 21:24027824-24027846 ATTAAAAAGGAGGTGGTGGGAGG - Intergenic
1178039954 21:28629255-28629277 ATTAGAAAGGAGGAGGTGGGTGG + Intergenic
1179753241 21:43480292-43480314 TTCTAAAAAGAGAAGGTTGAGGG + Intergenic
1180782194 22:18527311-18527333 TTTTAAAAGGACAAGTTGGGAGG + Intergenic
1181125743 22:20701340-20701362 TTTTAAAAGGACAAGTTGGGAGG + Intergenic
1181159465 22:20949491-20949513 ATTCAAGAGGTGGAGGTGGAAGG + Intronic
1181239083 22:21466649-21466671 TTTTAAAAGGACAAGTTGGGAGG + Intergenic
1181928740 22:26381707-26381729 AGGTATAAAGAGAAGGTGGAGGG + Intronic
1181932384 22:26412704-26412726 ACTGAAAAGGAAAAGATGGAAGG + Intergenic
1182229403 22:28825809-28825831 ATATATTAGGAGAAGGGGGAAGG + Intergenic
1182388452 22:29968515-29968537 ATTAAAAAGGAGAAGGGCAAAGG - Intronic
1182597337 22:31432183-31432205 ATTTAAAAGGCTAAGGTGGGAGG - Intronic
1183516449 22:38269586-38269608 CTTTAGAAGGCCAAGGTGGAAGG + Intronic
1185184010 22:49381767-49381789 AGTTAACAGGAGAAGGAGGGCGG - Intergenic
949332525 3:2937960-2937982 ATTTAGATGGAAGAGGTGGAAGG + Intronic
949446023 3:4134581-4134603 ATTCAAAAGCAGAAGGCAGAAGG + Intronic
949919432 3:8989488-8989510 GTTCAAAAGGAGAAGGAAGAAGG - Intronic
950290742 3:11782300-11782322 CTTTAAGAGGCCAAGGTGGATGG + Intergenic
951280625 3:20744738-20744760 ATTGTAAAGGAGAGGATGGAGGG - Intergenic
951340544 3:21481408-21481430 ATTTTAGAGGAGAATGTGTATGG - Intronic
951409900 3:22350287-22350309 TTTTAAAAGGAAAAGATGTATGG + Intronic
951578027 3:24133485-24133507 ATTTAAATGAAGAAGTTGAAGGG + Intronic
951802822 3:26615380-26615402 AGTTAGAGGGAGAAGGAGGAGGG + Intergenic
952594413 3:34998773-34998795 ATTTACATGCAGAAGATGGAAGG - Intergenic
953102771 3:39846085-39846107 ATTTAAAATGACAACATGGATGG + Intronic
953321511 3:41976579-41976601 ATTTAAAAGCAGAATCTGGCCGG + Intergenic
953483476 3:43272658-43272680 ATAAAAAGGGGGAAGGTGGAAGG - Intergenic
954284103 3:49606671-49606693 ATACAAAAGGGGGAGGTGGAAGG - Intronic
954303151 3:49711839-49711861 AGTGCAAAGGAGAAGGTGGTGGG - Intronic
954849428 3:53587809-53587831 ATGTAAAAGGAGAATCTGGTAGG + Intronic
954965076 3:54603255-54603277 ATTTAGGAGGAGGAGGTGGTGGG - Intronic
955087232 3:55715073-55715095 TTTTAAAAGATTAAGGTGGAAGG - Intronic
955243238 3:57199851-57199873 ATTGAAAAGGAGCAAGTTGAGGG + Exonic
955819325 3:62879438-62879460 ATTTACATGGACAAGATGGAGGG + Intergenic
955960904 3:64340465-64340487 ATTTAAGAAGAGATGGCGGATGG - Intronic
956012095 3:64842801-64842823 CTTTAGAAGGAAAAGGTGGAAGG + Intergenic
956421217 3:69087669-69087691 ATTTGAAAGGAAAATGAGGAGGG - Intronic
956567281 3:70652959-70652981 TTTTCAAAGTAGAAGCTGGAAGG - Intergenic
956780699 3:72600912-72600934 AGCTAATAGGAGAAGGTGGTAGG + Intergenic
956833966 3:73080551-73080573 AATGAGAAGTAGAAGGTGGAGGG - Intergenic
957164318 3:76651727-76651749 AGTTAAAAGGGGGAGATGGAAGG - Intronic
957202609 3:77156168-77156190 ATTTGAAAGGAGAAGGAGAATGG - Intronic
957510381 3:81180463-81180485 ATTTAGAAGAAAAAGGTGAAGGG + Intergenic
957618575 3:82566179-82566201 ATTTATCAGGAGAAGGTGTTTGG - Intergenic
957867017 3:86038952-86038974 ATTTAGAAGGAGAATCTGGAAGG + Intronic
958020680 3:87991407-87991429 ATTGCAAAGGAGGAGGTGAATGG + Exonic
958549961 3:95599635-95599657 TTTTACACGGAGAGGGTGGAGGG - Intergenic
958550434 3:95605834-95605856 ATTAAAAAGGAGAAGGTAAAAGG - Intergenic
958781110 3:98543440-98543462 ACTGAAGAGCAGAAGGTGGAAGG - Intronic
959080583 3:101796581-101796603 ACTAAAAAGGAGAGGGTGGCTGG + Intronic
959149220 3:102588628-102588650 ATTTAAGATGAGTAGGAGGAAGG + Intergenic
959291781 3:104484583-104484605 ATTTGGAAGGAGTAAGTGGATGG + Intergenic
960659657 3:120043850-120043872 GTTTAGATGGAGAAGGAGGAGGG - Intronic
962371177 3:134822006-134822028 GTTGAAAAGGAGGAGGAGGAAGG + Intronic
962628462 3:137250893-137250915 AGTTAAAAGGGGAAGTGGGAAGG + Intergenic
962787032 3:138778154-138778176 ATTTAAAAGGAGAAACCGAAAGG + Intronic
963097999 3:141566038-141566060 ATTTAAAAATAGAAGGAGGAAGG - Intronic
963244873 3:143048497-143048519 ATTTAAAAAGATAAGATGTAAGG - Intronic
963405382 3:144856626-144856648 AGTAAAGAGGAGAAGGGGGAGGG - Intergenic
963718918 3:148837490-148837512 AAAAAAAAGGAGAAGTTGGATGG + Intronic
963967572 3:151389839-151389861 TTTATAAAGGAGAAGATGGAAGG - Intronic
963974762 3:151468322-151468344 ATTTAAAATGAGAATGAGAAAGG - Intergenic
964036482 3:152205461-152205483 ATTAAAATGGGGAAGGAGGAGGG - Intergenic
964392942 3:156216273-156216295 ATTTATAGGGAGGAGGTAGATGG + Intronic
964503792 3:157376487-157376509 ATTGCAAAGGAGAAGGTGTCAGG - Intronic
965069144 3:163895120-163895142 ATTAAATAGCAGAAGGGGGAAGG + Intergenic
965811885 3:172599898-172599920 CCTTATAAGGAGCAGGTGGAGGG - Intergenic
966268775 3:178080184-178080206 CATGAAAAGGAGAAGGTGGGAGG - Intergenic
966458076 3:180141002-180141024 AGTTGAAAGGAGAAGATGGAGGG - Intergenic
966473681 3:180320663-180320685 ATTTACAAAGAGAAGGTGTCAGG - Intergenic
966728597 3:183131411-183131433 AGTTTGAAGGAGGAGGTGGAAGG + Intronic
966953661 3:184849713-184849735 ATCTAAAGGGAGAAGTAGGATGG + Intronic
967507200 3:190266016-190266038 ATAGAAAAGGGGAAGGAGGAGGG + Intergenic
967799895 3:193645065-193645087 ATATTAAAGAAGAAGGTGGGAGG + Intronic
967975740 3:195033931-195033953 ATTTAAAAGGACAAGGACCAGGG + Intergenic
969315000 4:6376774-6376796 TTTCAAAAGGAGCAGGTGCATGG + Intronic
969492031 4:7504995-7505017 GTTTACCAGGAGGAGGTGGAGGG - Intronic
970432653 4:16002918-16002940 ATTGAAAAGGAGGAAGAGGAGGG + Intronic
970588417 4:17536867-17536889 ATTTCAAGGGAGTAGGAGGAAGG + Intergenic
971162190 4:24144695-24144717 ATAGAAAAGGGGAAAGTGGAGGG - Intergenic
971251264 4:24975321-24975343 AGACAAAAGGAGAAGGGGGAAGG + Intronic
972195818 4:36652736-36652758 ATTCAAAAGCAGCAGGTGTATGG - Intergenic
972436696 4:39042176-39042198 ATTTAAAAGTAGAATTTGGCCGG - Intergenic
972520977 4:39856517-39856539 ATTTAAAAGGAAAATGCGGCTGG + Intronic
973816459 4:54623930-54623952 ATTTATAAGGAGAAGCTACATGG - Intergenic
974017086 4:56657175-56657197 AATTAGCAGGAGGAGGTGGATGG - Intronic
974197604 4:58595645-58595667 ATTTAAAAGGAAAAATAGGAAGG + Intergenic
974334018 4:60516503-60516525 ATTTAAAATGTGAAAATGGATGG + Intergenic
974433500 4:61828838-61828860 ATTTAACAGGAGAAGGGGCAGGG - Intronic
974447985 4:62011554-62011576 ATTTCAGAGGAGAAGGGTGAGGG + Intronic
974660279 4:64879513-64879535 TTTTATAAAGAGAAGGTGAAGGG - Intergenic
975288535 4:72649122-72649144 TTTTAAGAGGACAAGGTAGACGG - Intergenic
975403730 4:73965918-73965940 ATTAAAAAGGAGAATTTGGGAGG - Intergenic
975495415 4:75030890-75030912 ATGTAAGAGGAGGAGGAGGAGGG + Intronic
975684058 4:76902341-76902363 ACTTAGAAGGAGCAGCTGGAGGG + Intergenic
976324892 4:83759959-83759981 ATTTGGAAGGAGGAAGTGGAGGG + Intergenic
976639986 4:87328052-87328074 ATTTGAAAGGCCAAGGTGGGTGG + Intergenic
976997552 4:91454427-91454449 CCTTATAAGTAGAAGGTGGAGGG - Intronic
977914531 4:102577001-102577023 ATTTGCAAGCAGAAGGTGGAGGG + Exonic
978873737 4:113612016-113612038 ATTTAAAATAAGAGAGTGGAAGG - Intronic
979127107 4:116987520-116987542 ATTGAAAAGGAAAAGATGCAGGG + Intergenic
979309358 4:119184056-119184078 CTTTGGGAGGAGAAGGTGGATGG - Intronic
979785007 4:124705558-124705580 ATTTAAAAGGATATGGTGTTGGG - Intronic
980147950 4:129013136-129013158 ACTTGAAAGGAGAGGGTGGGAGG - Intronic
982266907 4:153546132-153546154 CTTTAAGAGGACAAGGTGGGAGG - Intronic
983219922 4:165034125-165034147 ATTTAAAATAAAAAGGTGCAGGG - Intronic
983570681 4:169204844-169204866 CTTCAAAAGGAGAAGGTGGCCGG - Intronic
984257684 4:177407792-177407814 ACTTTAAAATAGAAGGTGGAGGG + Intergenic
984444406 4:179817003-179817025 TTTTAAAAGAAGAAGGTTGGAGG + Intergenic
984795996 4:183660489-183660511 ATTAAAAAGTAAAACGTGGATGG - Intronic
984850693 4:184149992-184150014 AACTAGAAGGATAAGGTGGAGGG + Intronic
984886576 4:184455191-184455213 GGTTAGAAGAAGAAGGTGGAGGG - Intronic
985229107 4:187796045-187796067 ATTTGAAGGGAGAGGGAGGAAGG - Intergenic
985822375 5:2169071-2169093 AATTGCAAGGAGTAGGTGGAGGG - Intergenic
986363563 5:7006276-7006298 ATTTATAAGGTAAAGATGGAGGG + Intergenic
986551826 5:8965018-8965040 ACTTGAAAGTGGAAGGTGGAAGG + Intergenic
987495652 5:18641020-18641042 ATTTAAAAGGGAGAGGAGGACGG + Intergenic
987747925 5:22001299-22001321 ATTAATAAGGAGGAGGGGGACGG - Intronic
988092940 5:26566806-26566828 AATAAAAAGGAAAAAGTGGAAGG + Intergenic
988224669 5:28397876-28397898 TTTTAAAGGGAGAACGTGGGAGG + Intergenic
988845647 5:35124908-35124930 CTTTAACAAGAGAAGGTGTATGG + Intronic
988884955 5:35546634-35546656 ATTTAAAAGGAAAAGGAAAAAGG - Intergenic
988923686 5:35967501-35967523 GTTTAAAAGGTGAAGGTTCAAGG + Intronic
989740142 5:44761065-44761087 ATTAAAAACAAAAAGGTGGAGGG + Intergenic
989764022 5:45057715-45057737 ACTTAAATGGAGGAGGAGGATGG - Intergenic
990282209 5:54263442-54263464 ATTTAAAAAGATAAGGGTGAAGG + Intronic
990469244 5:56098560-56098582 ATTGTAAAGGAGAAAGTGTACGG - Intergenic
990628697 5:57642850-57642872 ATTTAAAAAGAGAAAGAGAAAGG + Intergenic
990742953 5:58930884-58930906 ATTTGACAGAAGATGGTGGATGG + Intergenic
990925080 5:61011661-61011683 ACCTAAAAGGAGATGTTGGATGG - Intronic
991526137 5:67560267-67560289 ATTTAAAATGTGAAGTTTGATGG + Intergenic
991768104 5:70011089-70011111 ATTAATAAGGAGAAGGGGAACGG - Intergenic
991847342 5:70886171-70886193 ATTAATAAGGAGAAGGGGAACGG - Intergenic
992417231 5:76563282-76563304 ATTTAAATTTAGAAGGAGGAGGG + Intronic
992595706 5:78345345-78345367 CATCAAGAGGAGAAGGTGGAGGG - Intergenic
993064037 5:83076835-83076857 AGTTAAGAGAAGAAGGTGGAAGG + Intronic
993573275 5:89569250-89569272 ATTTAAGTGGTCAAGGTGGAAGG - Intergenic
994354691 5:98782170-98782192 AGTTACAAAGAGAAGGGGGATGG - Intronic
994757188 5:103808982-103809004 AGGTAAAAGGAGAAGGGAGAAGG - Intergenic
994879738 5:105474369-105474391 ATTTTAAAGGAAATGGTTGAAGG + Intergenic
995532556 5:113106093-113106115 AGTGAACAGGGGAAGGTGGATGG - Intronic
995994172 5:118279696-118279718 ATGAAAAAGGAGAGGGTGAAAGG - Intergenic
998335753 5:141370935-141370957 ATTCAGAAGGAGAACCTGGATGG + Exonic
998491479 5:142550944-142550966 CTTTGGAAGGATAAGGTGGACGG - Intergenic
998611516 5:143694313-143694335 TTTAAAAAGGAGGAGGAGGAGGG - Intergenic
999352817 5:150892851-150892873 CTTTAAGAGGACAAGGTGGGAGG - Intronic
999728012 5:154453018-154453040 ATTTAAAAGGTGAGAATGGATGG - Intronic
1000536490 5:162484827-162484849 ATTGAAAAGGATGAGATGGAAGG - Intergenic
1000892120 5:166812575-166812597 AGATAAAAGGAGAAGTGGGAGGG + Intergenic
1002548173 5:179966487-179966509 ATTTAAAGGGAGATGTTGGAAGG - Intronic
1003099530 6:3166509-3166531 ATGTGAAAGGAGGAGGTAGAAGG - Intergenic
1003164601 6:3665267-3665289 GCTTATTAGGAGAAGGTGGAGGG - Intergenic
1003730844 6:8821992-8822014 ATTTTAAAGGAGTATGTGGTCGG + Intergenic
1003823651 6:9928090-9928112 AGTTCCAAGGTGAAGGTGGAAGG - Intronic
1003827841 6:9972129-9972151 CTTTCAGAGGCGAAGGTGGATGG - Intronic
1004440965 6:15653472-15653494 ATTTAAAAGCAGCAAGTAGAGGG - Intronic
1004466041 6:15885868-15885890 ATTTAAAAGGCGAAGTAAGAGGG - Intergenic
1004571307 6:16848261-16848283 ATTTCAAGGGAGAAGTTGCATGG + Intergenic
1004829178 6:19458805-19458827 TTTTTAAAGGAGGAGGAGGAAGG + Intergenic
1005033021 6:21529082-21529104 ATTGAAAAGGAGAAAGAAGAAGG - Intergenic
1005648294 6:27863459-27863481 ATTAAAATGGAGAAAGAGGAAGG - Intronic
1006514609 6:34538962-34538984 AATTAATATGAGATGGTGGAGGG + Intronic
1006658924 6:35622591-35622613 ACTTATAAGGAGCAGATGGATGG - Intronic
1006825838 6:36935314-36935336 ATTTAAAAAGAGAAAGAGAAAGG - Intergenic
1006970845 6:38043463-38043485 AGCTAAAAGAAAAAGGTGGAGGG - Intronic
1007754240 6:44088544-44088566 ATTTAAATGAAGAAGGAGGCTGG - Intergenic
1008051957 6:46909332-46909354 ATTTAAAAAGAGAAGGAGATCGG - Intronic
1009201667 6:60753471-60753493 ATTTAAAAAGTGGAGATGGAAGG + Intergenic
1009284431 6:61798014-61798036 ACTTGAGAGGAGAAGGTGGGAGG - Intronic
1010077101 6:71811539-71811561 CTTTAAGAGGCCAAGGTGGACGG + Intergenic
1010082367 6:71878760-71878782 CTTTGAAAGGCCAAGGTGGAAGG + Intergenic
1010698320 6:79006986-79007008 TTTTAAAAGGAGGAGATGGGAGG + Intronic
1010767547 6:79793340-79793362 ATCTAAAAGCAGAAGGTGTTAGG - Intergenic
1010769950 6:79816949-79816971 ATTCAAAAGGCTGAGGTGGAAGG + Intergenic
1011390915 6:86852357-86852379 ATTCAAAAGGAAAAGGAGAATGG + Intergenic
1011401972 6:86973158-86973180 ATTTAAAAGGAGAAGGTGGAGGG - Intronic
1011478113 6:87767527-87767549 TTTCTAAAGGAGAAGCTGGAGGG + Intergenic
1011726825 6:90218278-90218300 GTTTAAAAGAAGAAGGTGTTGGG - Intronic
1012621102 6:101344876-101344898 AGATAAAAGGAAAGGGTGGAGGG + Intergenic
1013297708 6:108774184-108774206 ATTTAAAAGGAAATTGTGCAAGG + Intergenic
1013576720 6:111490822-111490844 ATCTTTAAGGAGAAGGTAGAAGG + Intergenic
1013837115 6:114345707-114345729 ATTTGGGAGGAGAAGGTGGAAGG + Intergenic
1013851697 6:114523710-114523732 ATGGAATGGGAGAAGGTGGAAGG + Intergenic
1014026256 6:116649739-116649761 ATTTAAAAGTCTTAGGTGGAAGG - Intronic
1014664825 6:124223940-124223962 GTTTAAAATGAGATGGTGCATGG + Intronic
1015100168 6:129468681-129468703 ATTTAAAAGGAAAAGAAGAAAGG + Intronic
1015261370 6:131241280-131241302 ATGGAGAAGGAGAAGGAGGAGGG + Intronic
1015408728 6:132867625-132867647 ATTGAAAAGGAGAAGATACAGGG + Intergenic
1016002823 6:139059598-139059620 ATTTAAGAGGATGAGGTGGGAGG + Intergenic
1016225125 6:141725390-141725412 AAAGAAAAGGAGATGGTGGAAGG - Intergenic
1016418888 6:143863312-143863334 ATTTACAAAGAGCTGGTGGAGGG + Intronic
1017741960 6:157414425-157414447 ATTTTAAAGGTGGAAGTGGAAGG - Intronic
1018147819 6:160909491-160909513 CTTTAAATGGAAAAGCTGGATGG + Intergenic
1018482740 6:164208031-164208053 ATTTAGAAATAGAAGGTGGCGGG - Intergenic
1018572020 6:165221970-165221992 ATCTAAAAGCAACAGGTGGATGG + Intergenic
1019122340 6:169813235-169813257 ATTCGAAAGGAGAAGGGAGATGG - Intergenic
1020379483 7:7527491-7527513 ATTTAAAGGGAGTGGATGGAAGG + Intronic
1020440774 7:8214482-8214504 ACATAATAGGAAAAGGTGGATGG - Intronic
1020441876 7:8225765-8225787 AGATAAAAGGAGAAGCTAGAAGG - Intronic
1021143838 7:17060762-17060784 ATTAAAAAGATGAAGGTGAATGG - Intergenic
1021305261 7:19023931-19023953 AAGTAAAAGCAGAACGTGGATGG + Intronic
1021453074 7:20799341-20799363 ATTTATAAAGAGAAGGTGGGAGG - Intergenic
1021456765 7:20837931-20837953 AATTAAAAGCAGATGCTGGACGG + Intergenic
1021737948 7:23657457-23657479 GTTTAGAAGGAGAAGGAGTAGGG - Intergenic
1021971663 7:25971041-25971063 AGTAAACAGGAGACGGTGGATGG + Intergenic
1022239931 7:28500731-28500753 ATTTTAAGGGGGAAGCTGGAGGG + Intronic
1022576308 7:31500531-31500553 ATTGAAAAGTGGAATGTGGAAGG - Intergenic
1022645159 7:32223012-32223034 ATTTCAGGGGAGAAGCTGGAAGG - Intronic
1022890050 7:34687934-34687956 ATTTAAAAGCAGAAACTGGAAGG + Intronic
1023168598 7:37368089-37368111 ATTTTAAAGGAAAAGTTTGATGG - Intronic
1023309384 7:38868271-38868293 ATCTCAAAGGAGAAGGTTGCTGG + Intronic
1024249076 7:47492689-47492711 ATTTTAAAGGAAAAGGTCCAAGG + Intronic
1024527498 7:50361172-50361194 CTTTAAAAGGAGAAGGGAAAGGG - Intronic
1024770071 7:52712353-52712375 ATTAAGAAGGAGAGGATGGAGGG + Intergenic
1024805472 7:53134347-53134369 ATTTGAGAGGCCAAGGTGGAAGG + Intergenic
1025011923 7:55404307-55404329 ATTTAAAAGAAGAAGAAAGAAGG - Intronic
1025767354 7:64468035-64468057 ATTAAAAAGGAGATGGGGGCTGG + Intergenic
1026303384 7:69118926-69118948 CTTTAAGAGGACAAGGTGGGTGG - Intergenic
1027705034 7:81519717-81519739 ATTAAAAAGGATAAAGTAGAAGG + Intergenic
1027712346 7:81621042-81621064 ATTTAAAAGGACGAGTTGAAAGG - Intergenic
1027879702 7:83818789-83818811 TTTTAAAAGGTGAAAGTAGAGGG + Intergenic
1027978640 7:85188029-85188051 ATTTAAGAGCACAAGGTGTAGGG + Intergenic
1029731493 7:102441243-102441265 ATTTAAAAGAAAAAGCTGGCTGG + Intronic
1030354650 7:108528477-108528499 CTTTAGGAGGACAAGGTGGAAGG - Intronic
1030472570 7:109984904-109984926 ATTTAAAAGGCCAAGGCGGGTGG + Intergenic
1030583098 7:111384308-111384330 AGGGAAAAGGAGAAGGAGGAGGG + Intronic
1031181613 7:118425106-118425128 AATTAGAAGGAAGAGGTGGAAGG - Intergenic
1031279451 7:119778864-119778886 ATTTGAAAGGCTGAGGTGGAAGG - Intergenic
1031312288 7:120213471-120213493 ATTTAAGGGGAGAGGGTGGAAGG + Intergenic
1032155377 7:129463469-129463491 TTTTCAAAGGGGAAGATGGAAGG - Intronic
1032494584 7:132351613-132351635 ATTGTAATGGAGAAGGTGGATGG - Intronic
1033062185 7:138119745-138119767 ATTTGAGAGGCTAAGGTGGAAGG + Intergenic
1033180561 7:139173609-139173631 CTTTTTAAGGAGATGGTGGATGG - Intronic
1033558008 7:142505947-142505969 ATCCATTAGGAGAAGGTGGAGGG - Intergenic
1033615498 7:143010546-143010568 ATGTAATAGGAAAAGGTGCAAGG - Intergenic
1033816141 7:145075865-145075887 ATATAAGAGGAGAAGGAAGATGG - Intergenic
1033898158 7:146101337-146101359 TTTTAAAAGGAAATGGTTGATGG + Intergenic
1034326931 7:150244934-150244956 ATTTAAGAGGAGAATATTGATGG + Intronic
1034766275 7:153724517-153724539 ATTTAAGAGGAGAATATTGATGG - Intergenic
1034978901 7:155463399-155463421 AGGAAAAAGGAGAAGGAGGAGGG - Exonic
1036900217 8:12664792-12664814 ACGTAAAAGAAGGAGGTGGAAGG + Intergenic
1037166531 8:15836676-15836698 ATTTAAATGGTGTAAGTGGAAGG - Intergenic
1037200762 8:16249720-16249742 GTTTAAAAAGGGAAGTTGGAAGG + Intronic
1037674130 8:21039696-21039718 ATTTGAAAGGGAAAGATGGATGG - Intergenic
1038147994 8:24915435-24915457 ATTTAAAAGAAAAAGGGGGTGGG + Intronic
1039279662 8:35970144-35970166 ATTAAAAAAGAGAAGTGGGATGG + Intergenic
1040789365 8:51207252-51207274 AATTAAAAGGTGAAGTTGGGGGG - Intergenic
1041223162 8:55671690-55671712 ATTTCATGGCAGAAGGTGGAAGG - Intergenic
1041352548 8:56962643-56962665 ATTAAAATAGAGAAGGTTGAAGG - Exonic
1041540569 8:58980476-58980498 ATTTTAAAGAAAAAGGTTGAAGG - Intronic
1041630734 8:60083745-60083767 ATTTAACAGGAGAGGGTACATGG - Intergenic
1041746916 8:61217356-61217378 CTTTAAGGGGAGAAGGAGGAGGG + Intronic
1042069706 8:64917763-64917785 ATTTGCAAGGAGAAGGAGAAAGG - Intergenic
1042287615 8:67131276-67131298 ATTTGAAAGGCTGAGGTGGAAGG + Intronic
1043185097 8:77138257-77138279 AATTAAGAGGAGGAGGAGGAAGG - Intergenic
1043305179 8:78784871-78784893 CTTTTCAAGGAGAAGATGGAGGG - Intronic
1043385588 8:79744634-79744656 AAGTAAAAGGAGAAGGGGGATGG + Intergenic
1043457084 8:80423287-80423309 ATTTAAGGGGAGAAGGTGGAGGG - Intergenic
1043558913 8:81467786-81467808 AGTTTAAGGGAGAGGGTGGAAGG + Intergenic
1043671468 8:82890400-82890422 CTTAAAAAGAAGAAGATGGAGGG - Intergenic
1043796672 8:84550234-84550256 AAGGAAAAGGAGAAAGTGGAGGG - Intronic
1045145664 8:99341088-99341110 CTTTGTAAGGAGATGGTGGATGG - Intronic
1046939088 8:119913936-119913958 ATTTAGAAGGAAAAGCAGGAGGG - Intronic
1047162366 8:122395071-122395093 ATTCAAAAGGTGAAGAAGGAAGG - Intergenic
1047487928 8:125349503-125349525 ATTTGGAAGGCCAAGGTGGAAGG + Intronic
1047670203 8:127137605-127137627 ATTAAAAAAGAGAATGTGTATGG + Intergenic
1047800209 8:128301286-128301308 AGGGAAAAGGAGGAGGTGGAGGG + Intergenic
1048117188 8:131537564-131537586 ACTTAAAAGGAGAAGCTGGGGGG - Intergenic
1048210205 8:132448551-132448573 AGTAAAAAGGAGGAGGAGGAAGG + Intronic
1048696272 8:137031659-137031681 AATTAGGAGGAGAAGGGGGAGGG - Intergenic
1048836489 8:138523899-138523921 ATTTAAAAGGAGTGGGAGGATGG + Intergenic
1049037380 8:140087067-140087089 ATTTCAGAGGAGTAGGAGGATGG - Intronic
1050042055 9:1506363-1506385 TTTTAAAAGGAGAGGGAGGGAGG - Intergenic
1050195646 9:3080342-3080364 ATTTTAAATGAGAAAGTTGAAGG - Intergenic
1050609594 9:7337640-7337662 TTTTTAAAGGAGAAGGTAGATGG + Intergenic
1050777263 9:9280826-9280848 ATATTGAAGGAAAAGGTGGAGGG + Intronic
1050975559 9:11933423-11933445 ACTTGAAAGTAGAAGGTGGGAGG + Intergenic
1051198637 9:14592335-14592357 ATTTTAAAAGAGAAAGAGGAAGG - Intergenic
1051666978 9:19474823-19474845 ATTGATAAGGAGGAGGAGGAGGG - Intergenic
1051796446 9:20876855-20876877 AATTAAAAGGAGAAAGGGGCAGG - Intronic
1052394904 9:27927257-27927279 ATTTAATAGATGAAGGAGGAAGG + Intergenic
1053034385 9:34811490-34811512 ATTTCATGGCAGAAGGTGGAAGG - Intergenic
1053244781 9:36525787-36525809 ATTGAAAAGGAAAAGGGGGGCGG + Intergenic
1053352708 9:37424136-37424158 ACTGAGCAGGAGAAGGTGGAAGG + Intronic
1053657156 9:40228784-40228806 ATTGAAAAGGAGAACTTTGAAGG - Intronic
1053907519 9:42858078-42858100 ATTGAAAAGGAGAACTTTGAAGG - Intergenic
1054527440 9:66147442-66147464 ATTGAAAAGGAGAACTTTGAAGG + Intronic
1054676906 9:67864817-67864839 ATTGAAAAGGAGAATTTTGAAGG - Intronic
1055725751 9:79226394-79226416 TTTTAAAAGGAGAAGGAGGAAGG - Intergenic
1056066647 9:82942402-82942424 TTTTAAGAGGAGAAAGAGGATGG + Intergenic
1056486297 9:87061561-87061583 ATTTTAAAGGAGAAGGTGAAAGG - Intergenic
1056944912 9:90986056-90986078 ATATAAAAGTAGAAGCTAGAAGG + Intergenic
1057090101 9:92250325-92250347 ATTTAAGAGGAGAAAATTGAAGG + Intronic
1057642489 9:96837967-96837989 CTTTGAAAGGCCAAGGTGGACGG - Intronic
1057748564 9:97771842-97771864 ATTTACAAGCAGGAGGTTGAAGG + Intergenic
1058663926 9:107291888-107291910 ATTTAAAAGAAAAAGGTCTAAGG - Intronic
1059275431 9:113092702-113092724 CTTTTAAAGGACAAGGTGGGTGG + Intergenic
1059756626 9:117299763-117299785 AATTAAGATGACAAGGTGGATGG + Intronic
1060679561 9:125549656-125549678 ATACACAAGGAGAAGGCGGAGGG - Intronic
1061865742 9:133491023-133491045 AGTGAGAAGGAGAAGCTGGAGGG + Intergenic
1185695105 X:2188202-2188224 ATTTATAAGGGAAAGCTGGATGG - Intergenic
1185747101 X:2582569-2582591 ATTTTAATGGAGAATGTGGAGGG + Intergenic
1186500751 X:10048428-10048450 ATTAAAAAGGAGAAGTTTTAAGG - Intronic
1186514489 X:10156444-10156466 ATTTGAAAGGCGAGGGTGGAGGG + Intergenic
1186670573 X:11763787-11763809 CTTTGTAAGGAGATGGTGGATGG + Exonic
1186716459 X:12257031-12257053 AATTTAAATGAGAAGCTGGATGG - Intronic
1186954119 X:14661573-14661595 ATTTAAAAGTAGAAAATGGCTGG + Intronic
1187284707 X:17893840-17893862 ATTTAAAAGGTCAAGAAGGATGG - Intergenic
1187377119 X:18764983-18765005 ATTGAACAGGAGGAGGTGGGTGG + Intronic
1187400137 X:18952047-18952069 TTTTAAAAAGAGAAGGTAGCTGG + Intronic
1187500911 X:19837735-19837757 ATAAAAAAGGAAAAGGTGGCTGG - Intronic
1189588364 X:42485116-42485138 ATTTAAAAAGCAAATGTGGATGG + Intergenic
1189627929 X:42919700-42919722 AATTAAAACAAGAAGGTGAAGGG + Intergenic
1189651193 X:43191472-43191494 ATTTAAAAAGAAAAGTTGGATGG - Intergenic
1190182024 X:48200616-48200638 CTTTGAAAGGTCAAGGTGGACGG - Intronic
1190914877 X:54803936-54803958 GTTCACAAGGAGAAGGTGGGAGG + Intergenic
1191952998 X:66614928-66614950 ATTTTGAAGGAAAAGGAGGAAGG - Intronic
1193945678 X:87730440-87730462 ATTTAAATGGACAAAGTGAATGG + Intergenic
1193974981 X:88106808-88106830 ATTTACAAGGACAAAGTGTATGG + Intergenic
1194599652 X:95904465-95904487 AGTTAAAAAGAGAAGTTGCAAGG + Intergenic
1195227133 X:102808478-102808500 ATTTAAGAGGAAAAAGAGGATGG - Intergenic
1195482495 X:105362250-105362272 CTTGAAAATGTGAAGGTGGATGG + Intronic
1195942115 X:110175303-110175325 TTACAAAAGGAGAAGTTGGAAGG + Exonic
1196968959 X:121087723-121087745 AATTCAGAGGAGAAGGTGGGAGG - Intergenic
1197677469 X:129346093-129346115 ATTGCAAAAGGGAAGGTGGATGG + Intergenic
1197759233 X:130015917-130015939 GTGAAAATGGAGAAGGTGGATGG + Exonic
1198212667 X:134530194-134530216 AGATAAAAGGAGAAGGCGGCCGG - Intergenic
1198218424 X:134578031-134578053 AATTACAAGGGGAAGGTGGCAGG + Intronic
1198783907 X:140266718-140266740 ATTTAAAAGATGGAGGGGGATGG - Intergenic
1198948558 X:142042425-142042447 ATCTAACAGTAGAAGGTGAAGGG + Intergenic
1200277412 X:154747555-154747577 CTTTAGAAGGCCAAGGTGGAAGG + Intronic
1200336123 X:155353379-155353401 ATTTAAAAAAAAAAGGTGGGGGG + Intergenic
1200350347 X:155487848-155487870 ATTTAAAAAAAAAAGGTGGGGGG - Intergenic
1201918339 Y:19206615-19206637 ATTTAGCAGGACAAGGTGGGAGG - Intergenic