ID: 1011402145

View in Genome Browser
Species Human (GRCh38)
Location 6:86975217-86975239
Sequence TGGAATAAACTCAATGGAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 205
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 192}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011402145_1011402152 30 Left 1011402145 6:86975217-86975239 CCAACTCCATTGAGTTTATTCCA 0: 1
1: 0
2: 1
3: 11
4: 192
Right 1011402152 6:86975270-86975292 ATTTCCAATAGTGAAAAACCTGG 0: 1
1: 1
2: 6
3: 40
4: 435

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011402145 Original CRISPR TGGAATAAACTCAATGGAGT TGG (reversed) Intronic
901189420 1:7398592-7398614 TGGAATAAATTCAATGTAAATGG - Intronic
906149357 1:43578511-43578533 TGGCAGAAACTGAATGGAGCTGG + Intronic
908321926 1:62986947-62986969 TGGAATGAACTCGATGAAGAAGG - Intergenic
908623348 1:66010671-66010693 TGGAAGAAAGTCAATGAAGTGGG - Intronic
908623370 1:66010917-66010939 TGGAAGAAAGTCAAGGAAGTGGG + Intronic
910424689 1:87109004-87109026 ATGAATCAACTGAATGGAGTGGG - Exonic
911415935 1:97574380-97574402 TGGAAAAAAGTCAATAAAGTGGG + Intronic
911731743 1:101298673-101298695 GGGAATAATCTGAAAGGAGTGGG + Intergenic
913139505 1:115926599-115926621 TGGCATCAACTCAATGGTGCGGG + Intergenic
923264077 1:232296340-232296362 AGGAATAAACTTACTGGAGGTGG - Intergenic
923895704 1:238267523-238267545 TGGAATAGATTCAATAGAATTGG - Intergenic
1064085982 10:12347187-12347209 TGGAATAATGACATTGGAGTGGG - Intergenic
1066162786 10:32752126-32752148 TTGAATAAACTTAATGGTATAGG - Intronic
1066741495 10:38522618-38522640 TGGAATGGACTCAATGGGGATGG + Intergenic
1079907302 11:26264824-26264846 TGGAATAAAGTCATTAGGGTGGG - Intergenic
1081639709 11:44744446-44744468 TGCAAGAAACTCCATGGAGTGGG + Intronic
1085506085 11:77060479-77060501 AAGAATAAACTGAATGGATTAGG - Intergenic
1086712096 11:90021457-90021479 AGAAATAAAATAAATGGAGTGGG - Intergenic
1087321217 11:96661219-96661241 AGGAATAAACTGGATGGAATTGG + Intergenic
1092019985 12:5193667-5193689 TGCAATCAACTCACTGGTGTTGG - Intergenic
1092049491 12:5457756-5457778 TGGAGAAGACTCACTGGAGTTGG - Intronic
1092071960 12:5638594-5638616 TGGAATATACCCAGTGCAGTGGG - Intronic
1093815284 12:23538609-23538631 TGGAAGAAACTCAATGAAAACGG - Intronic
1093817024 12:23561344-23561366 TGGAATAAAGTGAATGCAGATGG + Intronic
1095187774 12:39221730-39221752 TGGAATCAACTCAATTCAGAAGG - Intergenic
1095794164 12:46198959-46198981 TGGAAGAAGCTACATGGAGTGGG + Intronic
1099061238 12:77912033-77912055 TGCCATAAACTCAATGCAGTAGG - Intronic
1101661323 12:106768077-106768099 TGGAATGAAGTCACTGGGGTGGG + Intronic
1105567124 13:21560675-21560697 TGCAATAATCCCAATGGGGTAGG - Intronic
1106097874 13:26665002-26665024 TAGAATAAAATGAATGGAGAAGG - Intronic
1106810565 13:33354414-33354436 TGGAAGAAACACAATGGAAGAGG - Intergenic
1107310026 13:39066877-39066899 AGGAATAAACTCAATAAAGAAGG - Intergenic
1108097377 13:46917715-46917737 TGGAATATACTCAAAGGAAAAGG - Intergenic
1108960817 13:56226482-56226504 TGGAATAATTTCAATAGCGTTGG - Intergenic
1112748348 13:102553128-102553150 TGGAAGAAACTCACCTGAGTGGG - Intergenic
1114698815 14:24655813-24655835 TGAGATAAACTCAATAAAGTAGG + Intergenic
1115381452 14:32744784-32744806 AGGAATAAAAACAATGAAGTAGG - Intronic
1116645097 14:47517633-47517655 TGCAATCAACTCAATGAACTTGG + Intronic
1119956172 14:78800925-78800947 CGGAATAAAATCAAAGGACTTGG - Intronic
1121973863 14:98384527-98384549 TGGAATAAACTAAGTTTAGTTGG + Intergenic
1122015272 14:98789805-98789827 TGAATTAAACTCAATGGAGATGG - Intergenic
1123848836 15:24332875-24332897 TGAAATAAGCTCACTAGAGTGGG - Intergenic
1124959551 15:34384188-34384210 TGAAAAAAACTCAGTGAAGTTGG + Intronic
1124976177 15:34530409-34530431 TGAAAAAAACTCAGTGAAGTTGG + Intronic
1127352935 15:58170877-58170899 TAGACTAAACTCAAGGGAGTTGG + Intronic
1127546453 15:59997819-59997841 TGGAATAAAATCGATGGGGGGGG - Intergenic
1128194927 15:65744242-65744264 AGGAAGAAACTCAATTGAGATGG + Intronic
1131644639 15:94328765-94328787 TGGACAAAGCCCAATGGAGTTGG + Intronic
1131973729 15:97919656-97919678 TGGAATAACCAGAATGAAGTGGG + Intergenic
1132471823 16:108562-108584 TGGAACAAACTCAATGGTGGGGG + Intronic
1136483896 16:30558807-30558829 TGTAAAAAAACCAATGGAGTGGG + Intergenic
1137666775 16:50254550-50254572 AGGAATAAATTCAACGGAGAAGG + Intronic
1140355246 16:74299692-74299714 TGGAATAAAGATGATGGAGTAGG - Intronic
1144259030 17:13499720-13499742 TTAAATAATCTCAATAGAGTAGG + Intronic
1145332120 17:21881393-21881415 TGGAAAAAACGCATTGGAATGGG + Intergenic
1145342958 17:21970463-21970485 TGGAATAAACTCAATTGCAATGG + Intergenic
1145343446 17:21973619-21973641 TGGAATAAACTCAATTGCAATGG + Intergenic
1145345438 17:21987053-21987075 TGGAATCAACCCGGTGGAGTGGG + Intergenic
1146247870 17:31306693-31306715 TGGAGTAAATTCAATCCAGTTGG + Intronic
1148832983 17:50447682-50447704 GGGAATACACTCAATAGAGGAGG + Intronic
1148994355 17:51696220-51696242 TGGAATAGTTTCAATAGAGTTGG + Intronic
1151093285 17:71466775-71466797 TGGAAAAAGCTCCATGGAGAAGG - Intergenic
1151155160 17:72119030-72119052 TGGAATAAAGTCAGTGAAGAGGG - Intergenic
1153325988 18:3820720-3820742 TGGAATAATCTCAATGAGCTAGG + Intronic
1153325997 18:3820883-3820905 TGGAATAATCTCAATGAGCTAGG + Intronic
1153566721 18:6426275-6426297 TGGCACTAACTCCATGGAGTTGG - Intergenic
1154948449 18:21184902-21184924 TTGAATGAACTCTATGGAGCAGG - Intergenic
1155311311 18:24526661-24526683 TGGAATAATCCCAATGGTATGGG + Intergenic
1156091155 18:33471550-33471572 TGTGATAAATTCAATGGAATAGG - Intergenic
1156360667 18:36381860-36381882 TGGTATCACCTCAAAGGAGTGGG + Intronic
1156969016 18:43132626-43132648 TGGAATAAACTACAGGGATTTGG + Intergenic
1157095602 18:44682991-44683013 TGGAATAAACAAACTGGAGGTGG + Intronic
1157682229 18:49616087-49616109 TAGAACAATTTCAATGGAGTGGG + Intergenic
1159521182 18:69527207-69527229 TGAAACAAACTCAGTGAAGTGGG - Intronic
1159528305 18:69622917-69622939 TGAAATAAACCCATTTGAGTCGG + Intronic
1160440560 18:78887507-78887529 TGGAATAGTTTCAATGGAATTGG - Intergenic
1161805732 19:6442041-6442063 TGGAATAACCTTCATGAAGTTGG + Exonic
1163405681 19:17120731-17120753 TTGAATAAACTGGCTGGAGTGGG + Intronic
1164766338 19:30774898-30774920 TGGAAAAATCTAAATGGAGCTGG - Intergenic
1167259152 19:48448533-48448555 TGGAAAAAATCCAATGAAGTAGG + Intronic
930401790 2:50899401-50899423 TTGAATAAACACAGTGTAGTGGG - Intronic
930891563 2:56394613-56394635 TTGAATAAACACAAAGGAGTGGG + Intergenic
932872673 2:75418666-75418688 TGAAATAAACTAGATGGAGATGG - Intergenic
933950608 2:87326267-87326289 TGGAATACTGTAAATGGAGTTGG + Intergenic
935923362 2:108039580-108039602 TGGAATTAAGTCAATGGCATTGG - Intergenic
936329170 2:111532312-111532334 TGGAATACTGTAAATGGAGTTGG - Intergenic
938702591 2:133892867-133892889 TGGAATAAAATAAATGGGATGGG + Intergenic
940552781 2:155182887-155182909 TTCAATAAACTGAATTGAGTTGG + Intergenic
941744878 2:169076584-169076606 TGGAATGAACTCTGTGGAGTGGG - Intronic
944215542 2:197251355-197251377 TAGAATAAATTCCAGGGAGTGGG + Intronic
945564666 2:211382569-211382591 TGGAAGAAACACACTGGATTGGG - Exonic
946916549 2:224528779-224528801 GGGAATAAATTCAAAGGAATGGG - Intronic
947031955 2:225806465-225806487 TGAAAGAAAGTTAATGGAGTTGG + Intergenic
948538354 2:238665125-238665147 TGGAACCAACTCATGGGAGTAGG - Intergenic
1169262290 20:4148117-4148139 TTTAATAAACTCTTTGGAGTAGG + Intronic
1170726644 20:18934018-18934040 TGGAATAATCTCAATAGGATTGG + Intergenic
1171931597 20:31233916-31233938 TGGAATGAACTCAATTGAAATGG + Intergenic
1173081670 20:39874333-39874355 GGGAAAAAATTCAATTGAGTGGG - Intergenic
1173356673 20:42299589-42299611 TGGAATAAACTCCTTGATGTTGG + Intronic
1175737675 20:61398633-61398655 TGGATGAAACTCCATGGTGTGGG - Intronic
1177035571 21:16038554-16038576 TGGAATAAACTCAGTGGTACAGG + Intergenic
1177625450 21:23654045-23654067 TGGAATAAATTCCCGGGAGTTGG - Intergenic
1179397812 21:41057321-41057343 TGGAATAGGCTCAATAGACTGGG - Intergenic
949238948 3:1846593-1846615 TGGAATAACCTCACTGAAGAGGG + Intergenic
950640368 3:14344634-14344656 TGGAAAAAACTCACTGGATTGGG + Intergenic
952024050 3:29057515-29057537 GGGAATAAACTCAGTGCTGTTGG + Intergenic
958061284 3:88484832-88484854 TGGAATAAAGTCTATGGTGCTGG + Intergenic
958192446 3:90199872-90199894 AGGGCTAAACTCAATGGAATAGG - Intergenic
958679566 3:97310214-97310236 TTGAATAAACTTATTTGAGTTGG - Intronic
958732782 3:97976323-97976345 TGGAATGAATTAAATGCAGTTGG + Intergenic
961150755 3:124635984-124636006 TGGAATAAATTCCCAGGAGTAGG + Intronic
963182986 3:142379992-142380014 TGAAATAAATTCAAAGGAGGTGG + Intronic
963325604 3:143859450-143859472 AGGAATATACTTAATCGAGTAGG - Intergenic
970283938 4:14488154-14488176 TGGAATAATGTCAATAGGGTTGG - Intergenic
970439916 4:16071797-16071819 TCCAAGAAACTGAATGGAGTAGG + Intronic
971114479 4:23628984-23629006 TGGAATAAAATGAATCAAGTAGG + Intergenic
972049093 4:34705729-34705751 TGGAATAGTGTCAATAGAGTTGG - Intergenic
974168425 4:58234426-58234448 AGGAAGAAAGTCACTGGAGTAGG + Intergenic
980639524 4:135558062-135558084 CAAAATAAACTCTATGGAGTTGG + Intergenic
982313909 4:154011925-154011947 TGGTATAAATTCATAGGAGTAGG + Intergenic
983255168 4:165391031-165391053 TGAAATAGACTCAAAGGAGAAGG - Intronic
985359095 4:189153528-189153550 TGGAATAAAATAACTAGAGTAGG - Intergenic
986936658 5:12896382-12896404 GGAAATAAATACAATGGAGTTGG + Intergenic
986986079 5:13502283-13502305 TAGAATAAGCTCTATGGAATAGG - Intergenic
987199367 5:15559240-15559262 TAGATTAAACTGAATGGAATTGG - Intronic
987917706 5:24237009-24237031 TGGCATGAACTCAAGGGATTTGG + Intergenic
988406070 5:30824476-30824498 TGGAATAATTTCACTGGAATTGG + Intergenic
990934647 5:61134903-61134925 TGGAATATACTCACTGAATTGGG - Intronic
991391883 5:66152863-66152885 TGGATTAAACTGAATCAAGTAGG + Intronic
993658183 5:90598128-90598150 AGGAAAAAACTCACTGGAGATGG + Intronic
994880995 5:105495982-105496004 AGGAATAAACTTAATCAAGTAGG + Intergenic
996446002 5:123551467-123551489 TGTCATAAACTCAATACAGTTGG - Intronic
998311170 5:141134352-141134374 TTGAATATATTCAAAGGAGTTGG - Intronic
999522782 5:152369577-152369599 TCCAATAAACATAATGGAGTTGG + Intergenic
999534364 5:152501172-152501194 TGGAGAAAACTCAAGAGAGTGGG + Intergenic
1002782166 6:375351-375373 TGGAATAAAGTGAAAGGACTTGG + Intergenic
1003167350 6:3692264-3692286 TAGAATAAACCCTATGGTGTTGG + Intergenic
1003468561 6:6406192-6406214 TGCAATAAACTCAATAAAATTGG - Intergenic
1004543880 6:16578032-16578054 TGTAATAAAATTAATGTAGTGGG - Intronic
1004591547 6:17056455-17056477 TGGAATAATCTTCATGGGGTGGG - Intergenic
1007513860 6:42395694-42395716 TGGAAAAAAATCCATGGACTAGG - Intronic
1007893855 6:45326864-45326886 TGGCATAAAGTAAATGGGGTGGG - Intronic
1007898482 6:45387025-45387047 TAGAGTTAAGTCAATGGAGTAGG + Intronic
1009648533 6:66442499-66442521 TGGAATAAACTCCATTGATGTGG - Intergenic
1009957784 6:70476536-70476558 TGGAATAAGCTGAAATGAGTAGG + Intronic
1010148781 6:72704797-72704819 TGTAATAAACTTAGTGGGGTAGG - Intronic
1011402145 6:86975217-86975239 TGGAATAAACTCAATGGAGTTGG - Intronic
1013856985 6:114584791-114584813 TGGAATAATGTCAATAGAATTGG - Intergenic
1013976533 6:116085174-116085196 TGGAAAAAATACAATGAAGTAGG + Intergenic
1014222036 6:118807385-118807407 TGGCAAAAACCCACTGGAGTGGG + Intergenic
1014469150 6:121793743-121793765 AGGAATAAATTAAATGGAGAGGG + Intergenic
1015756668 6:136613953-136613975 TGGAATAAACTCTATACATTAGG + Intronic
1015805158 6:137101342-137101364 TGGAAGAAACTCATTGGTCTAGG + Intergenic
1016448649 6:144158166-144158188 TGAAAAAATCTCAATAGAGTTGG - Intronic
1017704123 6:157105172-157105194 TCAAATAAACTCAAGGGAGATGG + Intronic
1018227965 6:161647950-161647972 TGGAATAAAATCAATAGAATTGG + Intronic
1018464234 6:164028673-164028695 TGTAATAAAAACAATGCAGTTGG - Intergenic
1018596086 6:165482149-165482171 TGGAATAAAGTCAGTAGAGAGGG - Intronic
1023110396 7:36805293-36805315 TGGAATAAACTCAAGAGACATGG - Intergenic
1023493035 7:40764611-40764633 TGGAATCAATTCAAGAGAGTAGG + Intronic
1024968664 7:55048956-55048978 TGGCACAGACTCAGTGGAGTGGG + Intronic
1026371272 7:69702111-69702133 TGGAAGCAGCTCAATGGAGAGGG + Intronic
1029568068 7:101352238-101352260 TGGAGTTAACTCAAGGGAGCAGG - Intergenic
1030266984 7:107630971-107630993 AGGAATAATCTGAATGGAGGCGG + Intergenic
1030605530 7:111635216-111635238 TGAAATAACCTCTATGCAGTTGG + Intergenic
1031188116 7:118509437-118509459 TGGAATAAAATCAATGCATCAGG - Intergenic
1031313978 7:120233952-120233974 TGGAATCAGCTTTATGGAGTGGG - Intergenic
1031419844 7:121538335-121538357 TGGAATAACCTTCATGAAGTAGG + Intergenic
1032591669 7:133197620-133197642 TGGACTAAACTCAATGCTGCTGG + Intergenic
1038018818 8:23536148-23536170 TGAGAAAAACTCAATGGAGCAGG - Intronic
1038361700 8:26885983-26886005 TGGAATACATTGACTGGAGTCGG - Intergenic
1039763959 8:40608430-40608452 GGAAATAAACTCAATGCTGTTGG - Intronic
1039779907 8:40774499-40774521 TAGAATAAATTCAAAGAAGTAGG - Intronic
1040844963 8:51827840-51827862 AGGAATAAATTCAATAGAATAGG - Intronic
1041505305 8:58590760-58590782 AGGAATAAACTCAATTGTTTTGG + Intronic
1041843991 8:62305992-62306014 TGGAATACACTGAAAGCAGTAGG - Intronic
1042439052 8:68803305-68803327 TGCAATAAACTCAATGTAGTAGG - Intronic
1042725563 8:71871791-71871813 AGGAATAAAGTTAATCGAGTAGG - Intronic
1043112392 8:76202449-76202471 AGGAATAAATTCAAGGGTGTGGG - Intergenic
1043288362 8:78563881-78563903 TGGAATAATCTATAAGGAGTAGG + Intronic
1043615923 8:82125223-82125245 TTGAATAACCTCAATCTAGTTGG - Intergenic
1045627415 8:104071400-104071422 TGGAATAAAAACTCTGGAGTTGG + Intronic
1046058005 8:109101266-109101288 TGGAATAGAATCAATAGAGTTGG + Intronic
1046196143 8:110865612-110865634 TTTACTCAACTCAATGGAGTTGG + Intergenic
1046913676 8:119657365-119657387 TAGAACAAACTCAATAGAGGAGG - Intronic
1047897838 8:129386240-129386262 TGAAATAAACTCACAGGACTGGG - Intergenic
1048547307 8:135399036-135399058 TTGAATATACTAAATGGAGAAGG - Intergenic
1051735488 9:20193978-20194000 AGGAATAGAATCAATGGAATAGG + Intergenic
1056039861 9:82653068-82653090 GGGAAGAAACTGAATGGAATCGG - Intergenic
1056124736 9:83523997-83524019 AGTAATAAACTCTGTGGAGTAGG - Intronic
1056844827 9:90028525-90028547 TGGTATTTACTCAAAGGAGTTGG + Intergenic
1058329973 9:103748343-103748365 TGTAATTAACTTAATGGATTTGG - Intergenic
1060310799 9:122459639-122459661 CTGAATGAACTCAATGTAGTTGG + Intergenic
1060552606 9:124492710-124492732 TGGAAATAACACACTGGAGTTGG - Intronic
1203343796 Un_KI270442v1:17195-17217 TGAATTAAATTCAGTGGAGTGGG + Intergenic
1203349340 Un_KI270442v1:62704-62726 TGGAATGGAATAAATGGAGTGGG + Intergenic
1187715680 X:22100254-22100276 TGGATCAGACTCAATGGAGGAGG - Intronic
1188094747 X:26007616-26007638 TGAAATAAACTCACTGAAATGGG + Intergenic
1188903191 X:35760336-35760358 TAGAATAAACTTAACGGAGGTGG + Intergenic
1189887264 X:45560705-45560727 TGGAATAATTTCAATAGAATTGG + Intergenic
1191031378 X:55976846-55976868 AGGAATAAACTTAACTGAGTGGG - Intergenic
1192734865 X:73840943-73840965 TAGAATAAACTTAAGGAAGTGGG - Intergenic
1194562558 X:95440557-95440579 TGGAATATACACTATGGAATTGG - Intergenic
1195734204 X:107996341-107996363 GGGAACAAACTCAGTGCAGTTGG + Intergenic
1196531026 X:116786459-116786481 TGGAATAAAGTCAATAGGATTGG - Intergenic