ID: 1011417629

View in Genome Browser
Species Human (GRCh38)
Location 6:87139189-87139211
Sequence GAACCACTTGGAGTTGATAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011417625_1011417629 -5 Left 1011417625 6:87139171-87139193 CCCTAGAAGAGATCCAGAGAACC No data
Right 1011417629 6:87139189-87139211 GAACCACTTGGAGTTGATACTGG No data
1011417624_1011417629 28 Left 1011417624 6:87139138-87139160 CCAGAAGATAAAGACACACATGA No data
Right 1011417629 6:87139189-87139211 GAACCACTTGGAGTTGATACTGG No data
1011417626_1011417629 -6 Left 1011417626 6:87139172-87139194 CCTAGAAGAGATCCAGAGAACCA No data
Right 1011417629 6:87139189-87139211 GAACCACTTGGAGTTGATACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011417629 Original CRISPR GAACCACTTGGAGTTGATAC TGG Intergenic
No off target data available for this crispr