ID: 1011418546

View in Genome Browser
Species Human (GRCh38)
Location 6:87148688-87148710
Sequence GTTCAATGCCTGGCACATAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011418546_1011418555 28 Left 1011418546 6:87148688-87148710 CCACTATGTGCCAGGCATTGAAC No data
Right 1011418555 6:87148739-87148761 AACAAACACTTGGGATAATCAGG No data
1011418546_1011418553 18 Left 1011418546 6:87148688-87148710 CCACTATGTGCCAGGCATTGAAC No data
Right 1011418553 6:87148729-87148751 TGATTCACAAAACAAACACTTGG No data
1011418546_1011418554 19 Left 1011418546 6:87148688-87148710 CCACTATGTGCCAGGCATTGAAC No data
Right 1011418554 6:87148730-87148752 GATTCACAAAACAAACACTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011418546 Original CRISPR GTTCAATGCCTGGCACATAG TGG (reversed) Intergenic
No off target data available for this crispr