ID: 1011418914

View in Genome Browser
Species Human (GRCh38)
Location 6:87152046-87152068
Sequence TTCGCGGGCGGCGGCGGCGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011418904_1011418914 12 Left 1011418904 6:87152011-87152033 CCGGGCCTGCAACTGCTGGGTGT No data
Right 1011418914 6:87152046-87152068 TTCGCGGGCGGCGGCGGCGGCGG No data
1011418906_1011418914 7 Left 1011418906 6:87152016-87152038 CCTGCAACTGCTGGGTGTCGGCG No data
Right 1011418914 6:87152046-87152068 TTCGCGGGCGGCGGCGGCGGCGG No data
1011418901_1011418914 27 Left 1011418901 6:87151996-87152018 CCGCGGCGGCAAACGCCGGGCCT No data
Right 1011418914 6:87152046-87152068 TTCGCGGGCGGCGGCGGCGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011418914 Original CRISPR TTCGCGGGCGGCGGCGGCGG CGG Intergenic
No off target data available for this crispr