ID: 1011422148

View in Genome Browser
Species Human (GRCh38)
Location 6:87184793-87184815
Sequence AAAGCTTCGAGGACCCTGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 88
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 85}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011422141_1011422148 21 Left 1011422141 6:87184749-87184771 CCTCAACCAAGGAAGCTGGTGGT 0: 1
1: 1
2: 0
3: 19
4: 158
Right 1011422148 6:87184793-87184815 AAAGCTTCGAGGACCCTGAGGGG 0: 1
1: 0
2: 0
3: 2
4: 85
1011422142_1011422148 15 Left 1011422142 6:87184755-87184777 CCAAGGAAGCTGGTGGTGTAACT 0: 2
1: 8
2: 50
3: 191
4: 556
Right 1011422148 6:87184793-87184815 AAAGCTTCGAGGACCCTGAGGGG 0: 1
1: 0
2: 0
3: 2
4: 85
1011422138_1011422148 28 Left 1011422138 6:87184742-87184764 CCTAAGGCCTCAACCAAGGAAGC 0: 1
1: 0
2: 0
3: 12
4: 157
Right 1011422148 6:87184793-87184815 AAAGCTTCGAGGACCCTGAGGGG 0: 1
1: 0
2: 0
3: 2
4: 85

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011422148 Original CRISPR AAAGCTTCGAGGACCCTGAG GGG Intronic
904776669 1:32913064-32913086 GAAGGTTCCAGGACCTTGAGAGG + Intergenic
907353886 1:53856253-53856275 AAGTCTTCAAGGGCCCTGAGGGG + Intronic
914196652 1:145451300-145451322 AAAGCCTTGAGCACCCTCAGAGG - Intergenic
918118743 1:181518919-181518941 AAAGCTTCGAAATCCCTGGGTGG + Intronic
920688496 1:208128044-208128066 AGAGCTGCGGGGAGCCTGAGGGG + Intronic
922572253 1:226641060-226641082 ACAGCTTCTGAGACCCTGAGGGG + Intronic
1067229903 10:44398921-44398943 AAAGCACAGAGGACCCTTAGAGG + Intergenic
1070404638 10:76083980-76084002 AAAGGCTCAAGTACCCTGAGAGG - Intronic
1076296246 10:129387132-129387154 GAAACATCGGGGACCCTGAGCGG + Intergenic
1076801063 10:132828842-132828864 AAAGGGACGAGGACGCTGAGCGG - Intronic
1077506334 11:2931484-2931506 ACAGCTTGGAGGACTCTGTGGGG + Intergenic
1082109483 11:48258548-48258570 AGAGCTTAGAGGCCCCGGAGAGG - Intergenic
1082889760 11:58126372-58126394 AAAGCTTATAGGACACAGAGAGG - Intronic
1083898581 11:65632720-65632742 AAAGCTTCAGGGACCGGGAGAGG - Intronic
1085304823 11:75479401-75479423 AAGGCTCCTAGGGCCCTGAGAGG + Intronic
1087361272 11:97162627-97162649 AAAGCTTAGAGAAACCAGAGAGG - Intergenic
1089176869 11:116554982-116555004 AAAGCTTCAAGAAGCCTGTGAGG + Intergenic
1092073407 12:5652557-5652579 ACAGCTTCGAGGAGTCTAAGGGG - Intronic
1092173106 12:6385376-6385398 AAAGGTCAGAGGTCCCTGAGGGG + Exonic
1102011019 12:109618430-109618452 AAAGCTTCCAAGACCCAGATTGG - Intergenic
1103255814 12:119540525-119540547 AAATCTTCCAGGATCTTGAGGGG + Intronic
1112877769 13:104066516-104066538 AAAGCTCCTAGAACCCTGTGTGG + Intergenic
1120685603 14:87532889-87532911 AAAGCTTCCTGGAGCATGAGAGG + Intergenic
1126251108 15:46569137-46569159 AAATCTTCCTGGACTCTGAGTGG - Intergenic
1131810646 15:96169520-96169542 ATACCCTCGAAGACCCTGAGTGG + Intergenic
1132390213 15:101433365-101433387 AAGACTTCTTGGACCCTGAGTGG + Intronic
1138403884 16:56772567-56772589 AGAGCTTCCAGGCCCCTGATGGG - Intronic
1145881474 17:28355943-28355965 AAAGCTCCTAGGATACTGAGGGG + Intronic
1146707636 17:35013040-35013062 AAAGCTTTCAGGACCCTGCCTGG - Intronic
1147758050 17:42781113-42781135 ACAGCTTCAGGGACCCTTAGCGG - Exonic
1153290494 18:3497432-3497454 AAAGCATCGATGGCTCTGAGAGG + Exonic
1153811339 18:8754670-8754692 AAAGCTACTAGGAACCTGGGTGG - Intronic
1153982623 18:10323339-10323361 ATTGCTTCGAAGACCCTGACTGG + Intergenic
1161583769 19:5094330-5094352 AAAATTGCGAGGTCCCTGAGCGG + Intronic
1164716192 19:30392095-30392117 TCAGCTTCCAGGACTCTGAGGGG + Intronic
1167590396 19:50401723-50401745 ACACCTTGGAGGACCCTGAGAGG + Intronic
1167768210 19:51498138-51498160 CAAGGTTCGAGGACTGTGAGGGG + Exonic
926955326 2:18288713-18288735 AATGCTTTGAGGAGACTGAGAGG + Intronic
940412929 2:153387417-153387439 CCAGCTGCCAGGACCCTGAGTGG - Intergenic
941106457 2:161359924-161359946 AAAGCTTCGAGAAGCTTGTGAGG - Intronic
946100356 2:217315339-217315361 TAAGTTTCTAGGGCCCTGAGTGG + Intronic
947246331 2:228052843-228052865 ACAGATTTGAGGCCCCTGAGTGG + Intronic
1169057313 20:2634318-2634340 AGAGATTCCAGGACCCTAAGGGG + Intronic
1171167343 20:22983679-22983701 AAAGCCTCAAGAAGCCTGAGGGG - Intergenic
1171421688 20:25021825-25021847 TCAGCTTCGAGGAGCATGAGAGG + Intronic
1174654019 20:52154622-52154644 CAAGCTTCTAGAACACTGAGAGG + Intronic
1179411651 21:41167734-41167756 AAAGTTTCGAGAACCCTTAAAGG - Intergenic
953357070 3:42264978-42265000 GAAGCTTCTCGGACCCAGAGGGG - Intronic
953930897 3:47005186-47005208 AAAGCTTTGAGGACCCAGCAGGG + Exonic
954619233 3:51986247-51986269 ACAGCTTCCAGGTACCTGAGGGG - Exonic
960142135 3:114161067-114161089 AAAGCCTCGCGGTCCATGAGTGG - Intronic
961337485 3:126190425-126190447 GAAGCTTCAAGGACTCAGAGAGG + Intronic
963162812 3:142169243-142169265 AGAGCTTGGAGGAGCCTGAGTGG - Intronic
963476176 3:145807621-145807643 AAAGCCTGGAGGAGCCTTAGCGG - Intergenic
967219286 3:187235530-187235552 ACAGCCCCCAGGACCCTGAGAGG - Exonic
967894598 3:194385757-194385779 CAAGCTTCAAGGACCCAGACAGG + Intergenic
969109862 4:4837592-4837614 AAAGCTACCAGGAACCTCAGAGG - Intergenic
969564887 4:7971742-7971764 GAAGCTGGGAGTACCCTGAGGGG - Intronic
971307994 4:25500579-25500601 AAAGCTTGGAGGACTGTGGGTGG + Intergenic
974012161 4:56616995-56617017 ATACCTTCCAAGACCCTGAGGGG + Intergenic
980106388 4:128592411-128592433 AAAGCATGGAGGAGCCTGTGTGG - Intergenic
981876559 4:149553656-149553678 AAAGATTTGAGCACCCAGAGTGG - Intergenic
983447412 4:167871234-167871256 AAAATTTCAAGGTCCCTGAGTGG - Intergenic
984914285 4:184707212-184707234 AAAGCTGTGAAAACCCTGAGGGG + Intronic
987551796 5:19392349-19392371 AGGGCTTCGAGGACCCACAGAGG + Intergenic
989183992 5:38605203-38605225 AAATTTTAGAGGGCCCTGAGGGG + Intronic
999772275 5:154784602-154784624 AAAGCCTTCAGGACCCAGAGTGG - Intronic
1001165037 5:169356995-169357017 AGAGCTGGGAGGACCCTCAGGGG - Intergenic
1004555925 6:16697921-16697943 AAAGCTTCCGGGTGCCTGAGTGG - Intronic
1006829092 6:36958143-36958165 AGAGCTTGGGTGACCCTGAGGGG - Intronic
1009868221 6:69424410-69424432 AAAGGGTCCAGGACCCTGAATGG + Intergenic
1011422148 6:87184793-87184815 AAAGCTTCGAGGACCCTGAGGGG + Intronic
1016057273 6:139591816-139591838 AAAGTTTGTAGGACCTTGAGGGG - Intergenic
1017502099 6:155035035-155035057 AAAGCTTCGTGGACCCATATAGG - Intronic
1018679347 6:166251636-166251658 AAAGGTTTGAGGACATTGAGAGG + Intergenic
1020023257 7:4881897-4881919 CAAGCTTCTAAGACCCTGGGAGG - Intronic
1029870094 7:103681248-103681270 TAAACTTCGAAGTCCCTGAGTGG - Intronic
1032079943 7:128853841-128853863 GAAGCCTGGAGGACCCTGGGTGG + Intronic
1035716562 8:1759610-1759632 AGGGCTTCGAGGACCCTGCCTGG + Intronic
1041132807 8:54720606-54720628 ATAGCTTCATGTACCCTGAGAGG + Intergenic
1046630740 8:116620594-116620616 ACATCTTCGAGGGCCATGAGGGG + Intergenic
1055947872 9:81707746-81707768 AATTCTACGAGGACCATGAGAGG - Intergenic
1055986356 9:82059224-82059246 ATAGGCTTGAGGACCCTGAGGGG + Intergenic
1056839392 9:89986341-89986363 AAAGCATGGAGAACCATGAGAGG - Intergenic
1062698080 9:137885534-137885556 AAAGCCTTGAGCACCCTCAGAGG + Intronic
1188526134 X:31089582-31089604 AAAGCTTTCAGCACCCTGGGAGG - Intergenic
1191693439 X:63964163-63964185 AGAGCTTGAAGGGCCCTGAGAGG - Intergenic
1196679499 X:118456205-118456227 AAATCTTCAAGTACCCTCAGGGG - Intergenic