ID: 1011428546

View in Genome Browser
Species Human (GRCh38)
Location 6:87258068-87258090
Sequence ACTACCTTCTTGACTGACAC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 109}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011428546_1011428547 -7 Left 1011428546 6:87258068-87258090 CCAGTGTCAGTCAAGAAGGTAGT 0: 1
1: 0
2: 0
3: 8
4: 109
Right 1011428547 6:87258084-87258106 AGGTAGTGAAATTATTAAACAGG 0: 1
1: 0
2: 0
3: 23
4: 212
1011428546_1011428549 9 Left 1011428546 6:87258068-87258090 CCAGTGTCAGTCAAGAAGGTAGT 0: 1
1: 0
2: 0
3: 8
4: 109
Right 1011428549 6:87258100-87258122 AAACAGGCTTTGGAAACTGCTGG 0: 1
1: 0
2: 2
3: 26
4: 307
1011428546_1011428548 -1 Left 1011428546 6:87258068-87258090 CCAGTGTCAGTCAAGAAGGTAGT 0: 1
1: 0
2: 0
3: 8
4: 109
Right 1011428548 6:87258090-87258112 TGAAATTATTAAACAGGCTTTGG 0: 1
1: 0
2: 4
3: 24
4: 292
1011428546_1011428550 29 Left 1011428546 6:87258068-87258090 CCAGTGTCAGTCAAGAAGGTAGT 0: 1
1: 0
2: 0
3: 8
4: 109
Right 1011428550 6:87258120-87258142 TGGCATTCCCAGTACATTTGAGG 0: 1
1: 0
2: 0
3: 10
4: 144
1011428546_1011428551 30 Left 1011428546 6:87258068-87258090 CCAGTGTCAGTCAAGAAGGTAGT 0: 1
1: 0
2: 0
3: 8
4: 109
Right 1011428551 6:87258121-87258143 GGCATTCCCAGTACATTTGAGGG 0: 1
1: 0
2: 1
3: 13
4: 173

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011428546 Original CRISPR ACTACCTTCTTGACTGACAC TGG (reversed) Exonic
901372979 1:8816852-8816874 ACTACATTATTGGCTGAAACTGG - Intronic
902301311 1:15504688-15504710 ACAATCTTCTCGACCGACACAGG + Exonic
903785293 1:25857163-25857185 AATACATTCTTGAATGACATGGG - Intronic
906576093 1:46891772-46891794 AATACCTTCTTCAGTGAGACAGG + Intergenic
906595827 1:47075814-47075836 AATACCTTCTTCAGTGAGACAGG - Intronic
907705281 1:56827258-56827280 ACTGCCTACTTGACAGAGACAGG - Intergenic
907927589 1:58968888-58968910 ATTTCCCTCTTGGCTGACACTGG - Intergenic
908979366 1:69935292-69935314 ACTACCTGCTTGAATAGCACAGG - Intronic
911988315 1:104659757-104659779 ACAACCTACTTGTCTGACAAAGG - Intergenic
920374255 1:205498789-205498811 ACTGCCTCCTTGACACACACAGG - Intergenic
921176281 1:212597633-212597655 ACAGCCTCCTTGACTAACACAGG + Intronic
921314166 1:213874935-213874957 GCTACCTTCATGACTGGCTCAGG + Intergenic
1068756859 10:60665167-60665189 AATACCTTCTTGAGGAACACTGG + Intronic
1083313426 11:61798559-61798581 ACTACATTCTTGACCACCACAGG - Intronic
1083495292 11:63046932-63046954 ACCACCTTCTTGTGTGAAACCGG + Intergenic
1087695740 11:101373878-101373900 ACTACCTTCTTGAATGCAAGTGG + Intergenic
1088281596 11:108140451-108140473 AATACCGTATTGACTGTCACAGG - Intronic
1089301994 11:117504466-117504488 ACTGTATTCGTGACTGACACTGG - Intronic
1092178258 12:6426061-6426083 ACTTCCTTCTTGACTGGGATAGG - Intergenic
1092679723 12:10965491-10965513 GCTACTTTCTTGTTTGACACTGG - Intronic
1092729272 12:11513005-11513027 ACACCCTTCTTCACTGAGACTGG - Intergenic
1095631804 12:44385428-44385450 ACTACTTTCTTGACTCCCAAAGG - Intronic
1095748489 12:45685895-45685917 ACTACCTTCTTGGCAACCACAGG - Intergenic
1097125788 12:56773887-56773909 ACTACCTTCTGCACTGGTACCGG + Exonic
1097148351 12:56957406-56957428 ACTACCTTCTGCACTGGTACCGG - Exonic
1097151978 12:56985904-56985926 ACTACCTTCTGCACTGGTACTGG - Intergenic
1103827823 12:123754139-123754161 TCTACCTTCTTGGTTTACACAGG + Intronic
1104074291 12:125376051-125376073 ACTACCTCCTTGACTTAACCAGG - Intronic
1108079742 13:46722688-46722710 TCTGCCTTCTAGACTGTCACTGG - Intronic
1108475160 13:50809067-50809089 TCTACCTACTTGACTGACCCAGG + Intronic
1109895019 13:68675700-68675722 TTTACTTTCTTGAATGACACAGG - Intergenic
1111433967 13:88181869-88181891 ACTATCTTTTTGACCAACACTGG + Intergenic
1112615529 13:101001277-101001299 ACTACTTTCTAGACTGAAATTGG + Intergenic
1114142144 14:19925373-19925395 ACTACCTTTTTGGTTCACACAGG + Intergenic
1115078154 14:29416208-29416230 ACAAGCTTCTTGATTTACACTGG - Intergenic
1117682575 14:58220374-58220396 CCTACCTACTTGTGTGACACTGG - Intronic
1117969709 14:61239749-61239771 ACTACCTTCTTGGTAAACACAGG + Intronic
1122210685 14:100172034-100172056 ACTGGCTGCCTGACTGACACAGG + Intergenic
1125039514 15:35168020-35168042 ATTAGCTTATTGAATGACACTGG + Intergenic
1126471950 15:49022121-49022143 ACTAACTGCTTAACTGAGACAGG + Intronic
1129834909 15:78696258-78696280 ACCACCTTCCTGACTGCCCCGGG + Intronic
1136088299 16:27901166-27901188 ACATACTTCTTGATTGACACAGG + Intronic
1138011985 16:53389716-53389738 ACAACATTCTTGAATGTCACTGG - Intergenic
1140611836 16:76609042-76609064 ACAACCTACTTGTCTGACAAAGG - Intronic
1143336939 17:6178522-6178544 ACTACCTCCTCTACAGACACAGG + Intergenic
1144096985 17:11908860-11908882 ACAGCCATCTTGACAGACACTGG - Intronic
1149476876 17:56969293-56969315 AATTCTTTCTTGACTTACACAGG - Intergenic
1149553366 17:57556099-57556121 ATTACATTCTTGATGGACACTGG - Intronic
1152042011 17:77909726-77909748 ACTACATTCTTGAATTTCACAGG - Intergenic
1153549658 18:6248304-6248326 ACTCCATTCTTGGATGACACAGG - Intronic
1160561529 18:79761034-79761056 ACTGCCTTCCTAACTGGCACAGG - Intergenic
1163208516 19:15822275-15822297 ACTACCTTCTTTATTTTCACAGG + Intergenic
1165824287 19:38696871-38696893 TCTGTCTTCCTGACTGACACAGG - Intronic
929719785 2:44356197-44356219 ACTCACAACTTGACTGACACTGG - Intronic
935436481 2:103040432-103040454 ACTACCTTTGTGACTCATACTGG - Intergenic
937733877 2:125266185-125266207 ACTACCTGAAAGACTGACACAGG - Intergenic
939897979 2:147815819-147815841 ACTACCTTCTTCATTGACAGAGG + Intergenic
939995698 2:148917229-148917251 AACACTTTCTTGACTGCCACAGG + Intronic
940901380 2:159129497-159129519 ACATCCTTCCAGACTGACACAGG + Intronic
941988538 2:171531733-171531755 ACTACCTGGTTGTCTGACCCTGG - Intronic
942040910 2:172061379-172061401 AATACCTTATTGACTGAAAAAGG - Intronic
945561511 2:211346342-211346364 ACTACCTTCTAGAATGGCAGAGG + Intergenic
945805416 2:214484342-214484364 ACTACCTAATTGTGTGACACTGG + Intronic
1169846705 20:10001397-10001419 ACTACATTCTTGATGCACACAGG + Intronic
1172889095 20:38251413-38251435 ATGACCTTCTGGACTGACCCAGG + Intronic
1172889401 20:38253237-38253259 ACGACCTTCTGGACTGACCCAGG + Intronic
1173990455 20:47298568-47298590 ACCCCCTTCTTGACCAACACCGG - Intronic
1176267871 20:64220203-64220225 ACCTCCTTCTTGACAGACAAGGG - Intronic
1178883220 21:36464879-36464901 ACTACCTGCTTCAATGACATAGG + Intronic
1179648188 21:42788504-42788526 ACTCCCTCCTTGACTCACGCTGG - Intergenic
1182138836 22:27933998-27934020 ACTGCCTTCTTGACTTTCATGGG + Intergenic
1182301886 22:29341675-29341697 ACCACCTCCTTGGCTGCCACCGG + Exonic
949253526 3:2017569-2017591 CCTACATTCTTGACAAACACTGG + Intergenic
953350453 3:42211494-42211516 CCTGCCTTCCTGACGGACACTGG - Intronic
959020330 3:101181647-101181669 ACTACCTTCTTGGTAGCCACAGG - Intergenic
961771374 3:129252601-129252623 ACTTCTTTCTTGATTAACACAGG + Exonic
963042632 3:141080734-141080756 ATTTCCTTTTTGGCTGACACAGG + Intronic
963585674 3:147184987-147185009 ACTAGCATGTGGACTGACACGGG + Intergenic
980101585 4:128546813-128546835 CCTACATTCTTGACTGATTCTGG + Intergenic
984246173 4:177277668-177277690 ACTTATTTCTTTACTGACACAGG + Intergenic
984396985 4:179214544-179214566 ACCACCTTCTTCACTGACAAAGG + Intergenic
987246617 5:16055333-16055355 ACTTCCTACATGGCTGACACAGG + Intergenic
989834811 5:45973826-45973848 ACAACCTACTTAACTGACAAAGG - Intergenic
990809496 5:59706407-59706429 CCTACCTTCTTGAACAACACTGG + Intronic
992506953 5:77396237-77396259 ACTACCTTCTTGGCAACCACAGG + Intronic
999180492 5:149666720-149666742 ACAAACTTCTTTGCTGACACAGG + Intergenic
1000848255 5:166308116-166308138 ATTACATTTTTGAGTGACACAGG + Intergenic
1005675922 6:28154725-28154747 TCCACTTTCTTTACTGACACAGG - Exonic
1006496264 6:34425712-34425734 ACTGCCTCCTTGCCTGGCACTGG - Intronic
1010816982 6:80369600-80369622 ACTGCCTTCTTGCCTGACTATGG + Intergenic
1011428546 6:87258068-87258090 ACTACCTTCTTGACTGACACTGG - Exonic
1012580319 6:100860984-100861006 TCCACCTTCTTCACTGTCACTGG - Intronic
1015707408 6:136103204-136103226 TCCACTTTCTTGAGTGACACTGG - Intronic
1016465784 6:144323737-144323759 ACAAGCTTCTTGACTGCCAGGGG + Intronic
1020678962 7:11213523-11213545 ATTTACTTCTTGTCTGACACTGG + Intergenic
1021080176 7:16355204-16355226 ACTACCTTCTTAACTAAAAATGG + Intronic
1022351593 7:29571330-29571352 AATACCTTCTTAAATGTCACAGG - Intergenic
1029400596 7:100342995-100343017 ACTCCCGTCTTGACTGAGTCTGG - Intronic
1031488080 7:122353874-122353896 CCTATCTTCTTGACTGATACAGG + Intronic
1031525080 7:122815515-122815537 TCTGCCTTCTTGAGTGAGACAGG - Intronic
1034259327 7:149744997-149745019 TCTACTTTGTTGACTGACCCAGG - Intergenic
1034524758 7:151650763-151650785 AAGACCTTCTTAAGTGACACTGG - Intronic
1041785270 8:61625156-61625178 GCTACCTTCTTTTCTGACAAAGG + Intronic
1042087875 8:65128476-65128498 ACAACTCTCCTGACTGACACTGG + Intergenic
1044894220 8:96872286-96872308 ACTGCATTTTTGACTGCCACTGG + Intronic
1045854481 8:106748458-106748480 ACTCTCTTCTTGAGTGACACTGG + Intronic
1046090645 8:109499357-109499379 ACTACTTTCTTCAGAGACACTGG - Intronic
1048727724 8:137406078-137406100 ACTACCTTCCTGACTGCCTCAGG + Intergenic
1051948461 9:22601235-22601257 TCTACATTTTTGACTGAAACTGG + Intergenic
1056282379 9:85054216-85054238 ACTATGTGCTTGACTCACACTGG - Intergenic
1060293348 9:122324768-122324790 ACTTCCCTCTTTACTTACACTGG + Intergenic
1060520746 9:124292602-124292624 ACTACCCTGCTGACTGACAGTGG - Intronic
1061101297 9:128494500-128494522 ACTGCCTTCGTGCCTGAAACAGG - Exonic
1190705002 X:53020130-53020152 ACTACCTTCTTGGCAACCACAGG - Intergenic
1192037722 X:67583550-67583572 ACCAACCTCTTGACTGACAGTGG - Intronic
1193052901 X:77120086-77120108 ACTCCCTTTTTGAATTACACTGG - Intergenic
1194871354 X:99136167-99136189 GCTGCCTGCTTGACTGACAGCGG + Intergenic
1196313958 X:114201104-114201126 ACCACCTTATTGCCTGACACAGG + Intergenic