ID: 1011428966 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 6:87264707-87264729 |
| Sequence | CTGAAGAAGCAGATGGGTGG TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1011428959_1011428966 | 20 | Left | 1011428959 | 6:87264664-87264686 | CCAGTGGGCCACTTGGAAAGATA | No data | ||
| Right | 1011428966 | 6:87264707-87264729 | CTGAAGAAGCAGATGGGTGGTGG | No data | ||||
| 1011428961_1011428966 | 12 | Left | 1011428961 | 6:87264672-87264694 | CCACTTGGAAAGATAGGAAGTTG | No data | ||
| Right | 1011428966 | 6:87264707-87264729 | CTGAAGAAGCAGATGGGTGGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1011428966 | Original CRISPR | CTGAAGAAGCAGATGGGTGG TGG | Intergenic | ||
| No off target data available for this crispr | |||||