ID: 1011428966

View in Genome Browser
Species Human (GRCh38)
Location 6:87264707-87264729
Sequence CTGAAGAAGCAGATGGGTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011428959_1011428966 20 Left 1011428959 6:87264664-87264686 CCAGTGGGCCACTTGGAAAGATA No data
Right 1011428966 6:87264707-87264729 CTGAAGAAGCAGATGGGTGGTGG No data
1011428961_1011428966 12 Left 1011428961 6:87264672-87264694 CCACTTGGAAAGATAGGAAGTTG No data
Right 1011428966 6:87264707-87264729 CTGAAGAAGCAGATGGGTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011428966 Original CRISPR CTGAAGAAGCAGATGGGTGG TGG Intergenic
No off target data available for this crispr