ID: 1011432199

View in Genome Browser
Species Human (GRCh38)
Location 6:87299656-87299678
Sequence TTTCTGTTGTCACCAAAATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 270
Summary {0: 1, 1: 0, 2: 0, 3: 30, 4: 239}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011432199_1011432202 13 Left 1011432199 6:87299656-87299678 CCAGATTTTGGTGACAACAGAAA 0: 1
1: 0
2: 0
3: 30
4: 239
Right 1011432202 6:87299692-87299714 GATACAGCTATTGCTACTGGTGG 0: 1
1: 1
2: 6
3: 14
4: 125
1011432199_1011432201 10 Left 1011432199 6:87299656-87299678 CCAGATTTTGGTGACAACAGAAA 0: 1
1: 0
2: 0
3: 30
4: 239
Right 1011432201 6:87299689-87299711 GAAGATACAGCTATTGCTACTGG 0: 1
1: 0
2: 1
3: 18
4: 232
1011432199_1011432203 18 Left 1011432199 6:87299656-87299678 CCAGATTTTGGTGACAACAGAAA 0: 1
1: 0
2: 0
3: 30
4: 239
Right 1011432203 6:87299697-87299719 AGCTATTGCTACTGGTGGTCTGG 0: 1
1: 0
2: 1
3: 2
4: 88

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011432199 Original CRISPR TTTCTGTTGTCACCAAAATC TGG (reversed) Intronic
901467207 1:9429965-9429987 TTTCTTTTTTCCCCAGAATCCGG + Intergenic
901881486 1:12196585-12196607 CTTTTCTTGTCACCAAAATCAGG - Intronic
902817051 1:18922463-18922485 TTTCTCTTGTTTCCAAAAGCCGG - Intronic
903298485 1:22361245-22361267 TCTCTGTTTTAACAAAAATCAGG + Intergenic
907022523 1:51082314-51082336 TTTATGTTGTCACAAATAACAGG + Intergenic
907355592 1:53870618-53870640 TTTCTATTGTCTCCAAAATGTGG + Intronic
908234437 1:62136371-62136393 ATTCTGGTGTCACTAAAATCAGG + Intronic
908855404 1:68421239-68421261 TTTTTGTTGTAACCAAAACCTGG + Intergenic
911192586 1:94962578-94962600 TTTCTGTTTTCCCCAAGGTCAGG - Intergenic
911237420 1:95426171-95426193 TTCCTGTTGTCACTAATCTCTGG - Intergenic
911320593 1:96409427-96409449 TTTCAGTTGTCTCTAAAAGCAGG + Intergenic
914855354 1:151346580-151346602 TTTCTGAAGTCTCCTAAATCTGG + Exonic
916895236 1:169155415-169155437 TTTTTGTTATCACCATAAACAGG - Intronic
917426836 1:174923293-174923315 TTTCAGTTTTCTCCAATATCTGG - Intronic
918155571 1:181842770-181842792 TGTCTGTTAACACCAATATCTGG + Intergenic
919971283 1:202581000-202581022 TTTCTCTTGGCACCCCAATCAGG - Exonic
921113885 1:212068046-212068068 ATACTGTTGTCTCCAATATCAGG - Intronic
921162095 1:212480297-212480319 TTTCAGTTCTCTCCCAAATCTGG + Intergenic
922174256 1:223183362-223183384 GTTCTGATGTCACCAAAAAAAGG - Intergenic
923508037 1:234623577-234623599 TTACTGTAGTCACAAAAATCAGG + Intergenic
924637621 1:245803781-245803803 CTTCTGTTGGCTTCAAAATCAGG - Intronic
1064419820 10:15181063-15181085 TTCATGTTGTCTCCAAAATGAGG + Intergenic
1064884464 10:20094562-20094584 TTTCTGATCTCATCAAAGTCTGG + Intronic
1065936189 10:30522579-30522601 TTTCTCTTATTACCAAAAACGGG + Intergenic
1068412800 10:56679277-56679299 TTTTAGTGGTCACCAACATCTGG + Intergenic
1068485451 10:57652771-57652793 TTTCTGTTGTATTCAAAATAGGG - Intergenic
1068631336 10:59301185-59301207 TTTCTGTTATGGCCAAAATTTGG - Intronic
1068915249 10:62424667-62424689 TTTCTGATATAACCAAAGTCTGG + Intronic
1069268388 10:66492596-66492618 TTCCTGTTGTCAAAAAAATGGGG - Intronic
1071728940 10:88228534-88228556 TTACTGTATTCACCAATATCTGG - Intergenic
1073253822 10:102138427-102138449 TCTCTGTTGACACCAAGAGCTGG + Intronic
1073662951 10:105497634-105497656 TTTCTATTGTCATCAGAATAAGG + Intergenic
1073772650 10:106752262-106752284 TTTCTTTTGTCCCCAAAAGCAGG + Intronic
1073835218 10:107433831-107433853 TTTCTGTTTTCACCTTCATCTGG + Intergenic
1075176261 10:120164097-120164119 CTCCTGTTGTCCCCAAAGTCTGG + Intergenic
1076561912 10:131372451-131372473 GTTCTGTGGTCACCTAAACCTGG + Intergenic
1080374171 11:31688092-31688114 TTTATGTTTTCACGCAAATCAGG + Intronic
1081056188 11:38413364-38413386 AGTCTTTTGTCACCAAGATCAGG + Intergenic
1083374140 11:62205928-62205950 TTTCTGTCCTCCCCAAAATTAGG + Intergenic
1083870854 11:65487691-65487713 TTCCTCTTGCCACCGAAATCTGG - Intergenic
1085223592 11:74896935-74896957 TTACTGTAGTCATCATAATCTGG - Intronic
1086903527 11:92393858-92393880 TTTCTGTTGACACTAACATGGGG + Intronic
1088065044 11:105707145-105707167 TTTCTATTGTCATCAAAGCCAGG - Intronic
1090304742 11:125681535-125681557 TTCCTGCTGTTACTAAAATCTGG + Intergenic
1090334307 11:125952452-125952474 TATATCTTGTCTCCAAAATCTGG + Intergenic
1090831425 11:130423412-130423434 TTTCTGTTGTCATCCAAACCAGG + Intronic
1092567946 12:9687995-9688017 TTTCTGATGACACCAAGAACTGG + Exonic
1093419885 12:18963686-18963708 TTACTGTAGTCATCACAATCTGG + Intergenic
1097091846 12:56511908-56511930 TTTCTATTGTCACCAAACCCTGG - Intergenic
1098555936 12:71819107-71819129 GTTCAGTTGTCACCAAACTCTGG + Intergenic
1098702908 12:73652013-73652035 TTTGTGTCCCCACCAAAATCTGG + Intergenic
1099658795 12:85528924-85528946 TCTCTGTTATCACTAAAATAGGG - Intergenic
1100681270 12:96924877-96924899 TTTATTTTGTCCCCAAATTCTGG + Intronic
1100699639 12:97133464-97133486 TTTCTGTTAACACTAATATCTGG + Intergenic
1101670326 12:106865491-106865513 TTTCTGTTTTCAGGAATATCGGG - Intronic
1102436350 12:112926973-112926995 TTTCTCTTATTACCAAAAACAGG - Intronic
1102532253 12:113555183-113555205 TTTTGGTTGTCTCCAAAATGGGG + Intergenic
1102677889 12:114670625-114670647 TTCCTATTTTCACCAAAATTGGG - Exonic
1103871794 12:124097558-124097580 TTCCTGTTGCCACCAAATTGAGG + Intronic
1104447130 12:128843725-128843747 TTTTTGTTGTAACTAAAATAGGG + Intergenic
1105994079 13:25653642-25653664 TTGCTGTTGTCTCCTTAATCAGG + Intronic
1106336942 13:28792059-28792081 TATCTGTTGTCAGCAAACACTGG + Intergenic
1108685006 13:52811761-52811783 ATTCTGATGTCACTAAAATGGGG - Intergenic
1109095526 13:58109242-58109264 TTTCTGTTAAAACCAAGATCTGG + Intergenic
1109435858 13:62301253-62301275 TTTCAGTTGTTGCCAAAGTCTGG + Intergenic
1110077750 13:71270187-71270209 TTTCTGTTGTCATCTTCATCAGG - Intergenic
1110564696 13:76946523-76946545 TTTTGGTTGTCACCAAATTGTGG - Intergenic
1111797632 13:92943669-92943691 TTTCTGTCGTTTGCAAAATCAGG - Intergenic
1112967691 13:105218313-105218335 GCTCTGTTGTCACGAAATTCCGG + Intergenic
1113149329 13:107243964-107243986 CTTCTGAAGTCACAAAAATCAGG + Intronic
1115133804 14:30085621-30085643 TTTGTGTAGTTACCAAAATTTGG - Intronic
1115514329 14:34170270-34170292 TTTATGTTGTCTTCAAAATCTGG - Intronic
1116015403 14:39401238-39401260 TTTCGGTTGTCACTAAGATCTGG + Exonic
1116311962 14:43338665-43338687 CTTCTGTTGTTACTGAAATCTGG + Intergenic
1116314414 14:43369247-43369269 TTTTATTTGTCACCTAAATCTGG - Intergenic
1116540344 14:46094444-46094466 TTTCTATTGTTAACAATATCAGG - Intergenic
1117550935 14:56835260-56835282 TTTCAGGTGTCTCTAAAATCTGG + Intergenic
1117583868 14:57180147-57180169 TTTCTCTTATTACCAAAAACGGG - Intergenic
1120721560 14:87894641-87894663 TTTCTGTAGTCAGCAAAAGAGGG - Intronic
1121377451 14:93426367-93426389 TTTTTTTTGTCACCAAATTTTGG + Intronic
1124831762 15:33155577-33155599 TTACTGTTGACACCAAATTTGGG - Intronic
1125087061 15:35742459-35742481 TTTATTTTGTCACCAACAGCAGG + Intergenic
1127753775 15:62069861-62069883 TTTGTTTTTTCACCAAAAGCAGG - Exonic
1128463803 15:67891659-67891681 TTCCTGCTTTCACTAAAATCTGG - Intergenic
1128957160 15:71960316-71960338 GTTCTGAATTCACCAAAATCTGG + Intronic
1131779937 15:95845244-95845266 TTTCTCCTGTCACCAAAGACAGG - Intergenic
1134228574 16:12411444-12411466 TTTCTGTTTTCACCTACATCAGG - Intronic
1135334940 16:21593328-21593350 TTTCTGTTGTCACAATTATTGGG + Intergenic
1135859149 16:26039015-26039037 TCTCTGATGTCACCGAGATCAGG - Intronic
1138074408 16:54026534-54026556 TTGCTGCTCTCAACAAAATCAGG + Intronic
1139103712 16:63801317-63801339 TCTGTTTTGTCACCAAAAGCTGG + Intergenic
1143431770 17:6893439-6893461 TTTATGTATTCACCAAAATTGGG + Intronic
1143936123 17:10485582-10485604 TTTCTCTTATTACCAAAAACGGG - Intergenic
1147960108 17:44162127-44162149 TTGCCGTTGGCACCAGAATCCGG + Exonic
1148125978 17:45237140-45237162 CTTCTGTGGCCACCAAAACCTGG - Intronic
1148375256 17:47138470-47138492 TTGCTGTTGTCACCAAGATTAGG - Intronic
1153108626 18:1558379-1558401 CTTGTTTTGTCACCAAAATATGG + Intergenic
1153647432 18:7207726-7207748 TTCCTGTTGGCATCAAAATCTGG - Intergenic
1153721558 18:7908681-7908703 CTTCTGTTGTCAGCAAAACTGGG + Intronic
1153920253 18:9782591-9782613 TATCTGTGGAAACCAAAATCTGG - Intronic
1155666417 18:28315080-28315102 TTTCTTTTGACATCAAAATGAGG + Intergenic
1155772431 18:29718997-29719019 TTTTTCTTGTTACCAAAATAAGG + Intergenic
1155821230 18:30380455-30380477 TTTCTGTTTTCACAAATATATGG - Intergenic
1157989969 18:52483046-52483068 TGTCTGGAGTCACCAAAAGCTGG - Intronic
1159031817 18:63239439-63239461 ATTCTGGTGACACAAAAATCAGG + Intronic
1159595435 18:70378477-70378499 TATCTGTTCTCTCCAGAATCGGG - Intergenic
1161356680 19:3823042-3823064 TTCCTGCTGATACCAAAATCCGG + Intronic
1163240574 19:16060728-16060750 TTTCTGTACACCCCAAAATCAGG - Intergenic
1165961984 19:39542454-39542476 TATATGTTGTCACCTAAGTCTGG - Intergenic
1166431857 19:42734605-42734627 TTTCTCTTGAGACCAAAATAAGG + Intronic
1166447819 19:42873582-42873604 TTTCTCTTGAGACCAAAATAAGG + Intronic
1166452280 19:42912396-42912418 TTTCTCTTGAGACCAAAATAAGG + Intronic
1166481810 19:43180697-43180719 TTTCTCTTGAGACCAAAATAAGG + Intronic
1166484280 19:43199813-43199835 TTTCTCTTGAGACCAAAATAAGG + Intronic
1166491399 19:43263691-43263713 TTTCTCTTGAGACCAAAATAAGG + Intronic
925826546 2:7853805-7853827 TATCTGTTTTCTCCATAATCTGG - Intergenic
926279875 2:11437108-11437130 TTTCTGTTCTTGCCATAATCTGG - Intergenic
926337332 2:11874523-11874545 ATTCTGTTGTCACAATAAACAGG + Intergenic
927404982 2:22756390-22756412 TATCTGTAGTAGCCAAAATCTGG - Intergenic
928126419 2:28619794-28619816 CTTCTGAGGTCACCATAATCTGG - Intronic
928709119 2:33984884-33984906 TTTCTGTACTCACTAAAATATGG + Intergenic
928897171 2:36279502-36279524 TTTCTCTTATTACCAAAAACGGG + Intergenic
931437200 2:62258037-62258059 TTTCAGTTTTCTCCAATATCTGG - Intergenic
935824825 2:106935185-106935207 CTTCTGTTTCCTCCAAAATCAGG - Intergenic
937730928 2:125228107-125228129 ATTATGTTGTCACAAATATCTGG - Intergenic
938191432 2:129285211-129285233 TATTTGTTGTCACCAAGAACTGG - Intergenic
939129778 2:138221292-138221314 TTTCTCTGAGCACCAAAATCTGG + Intergenic
940071065 2:149688455-149688477 TTTCTGATGTCACAAGAAGCTGG - Intergenic
940469322 2:154074597-154074619 ATTCTCTTGATACCAAAATCTGG + Intronic
940514369 2:154662158-154662180 TTTCCATTTTCACCAATATCAGG - Intergenic
940956040 2:159728748-159728770 GGTCTGTTGTTTCCAAAATCTGG - Intronic
941392674 2:164934021-164934043 GTTCTGTTGTCAACAAAATGTGG - Intronic
942444630 2:176069926-176069948 TTTGTGGTGTGACCACAATCAGG - Intergenic
942472758 2:176278620-176278642 TTTCAATTTTCACCAAAATATGG - Intronic
942888989 2:180964592-180964614 TTTATTGTGTCACCAAATTCTGG + Intergenic
944151248 2:196561082-196561104 TTTCTCTTATTACCAAAAACGGG + Intronic
944241527 2:197490237-197490259 TTTCTATTGTCACCAAACCCTGG + Exonic
948337849 2:237224473-237224495 TTTCTGCTTTCACCAAACCCAGG + Intergenic
1170679423 20:18512261-18512283 TTTCTGTTTTCAAAGAAATCAGG + Exonic
1172681793 20:36721647-36721669 TTTCTGTTTTCACTAAAATATGG - Intronic
1173757857 20:45534073-45534095 TTTCTGGTGACACCAAAAAAGGG - Intergenic
1174967553 20:55234880-55234902 TTTGTGTTGTCACAAATTTCAGG - Intergenic
1175473471 20:59251272-59251294 TTTCTGGTGTCACCACAGCCTGG - Intronic
1177928783 21:27252919-27252941 TTGATAATGTCACCAAAATCTGG + Intergenic
1178064393 21:28888067-28888089 TTTCTATTGTCACCAAACCCTGG + Intergenic
1183514406 22:38255599-38255621 TATCTGTAATCATCAAAATCTGG + Intronic
949558823 3:5184178-5184200 TTTCTGTTTTCAGGAAAAACTGG - Intergenic
950343560 3:12271235-12271257 TTTCTTGTGTAACCACAATCCGG - Intergenic
950510600 3:13423808-13423830 TTACTGTTGTCACAAAAAGATGG - Intergenic
952093258 3:29917241-29917263 TTGCTATTTTTACCAAAATCTGG - Intronic
952876872 3:37952751-37952773 TTCCTGCTCTCAACAAAATCAGG + Intronic
953820662 3:46205055-46205077 TTGTTGTTGTCACCAAAACTGGG + Intronic
954190383 3:48955831-48955853 TCTCTCTTGTGACCCAAATCAGG + Intronic
956142962 3:66164241-66164263 TTTCTCTTGTAACAAACATCTGG + Intronic
956534591 3:70261666-70261688 ATTCTGTTTTCAACAAAATAAGG - Intergenic
958415671 3:93869942-93869964 TTTCAGTTTTTACCAAACTCAGG + Intergenic
958429394 3:94019802-94019824 TTGCTGTTCTCACACAAATCTGG + Intronic
959281695 3:104349756-104349778 TTTTTGTTGGCATCAAAATTTGG + Intergenic
961030815 3:123601983-123602005 TTTCTGTAGTCACTACATTCTGG - Intergenic
966681157 3:182643504-182643526 TTTCTGAAGGCAACAAAATCTGG + Intergenic
967044818 3:185726903-185726925 CTTCTGTTGTTTCCAGAATCTGG - Intronic
967216721 3:187217340-187217362 CTTCTGTTGTTAATAAAATCCGG + Intronic
969893024 4:10277091-10277113 ATTCTGCTGTCACAAAAAACTGG + Intergenic
971886205 4:32451562-32451584 TTTGTCTTGTCACCAAAGACTGG - Intergenic
972662185 4:41127160-41127182 TTTTTTTTGTAATCAAAATCAGG - Intronic
974320681 4:60345184-60345206 TTTTGGTTGTCACCAAAATGTGG - Intergenic
974358356 4:60842271-60842293 TTTCTTATGTCACCAAAAATAGG - Intergenic
974813468 4:66975805-66975827 TCTCCGTTGTCAGTAAAATCTGG - Intergenic
975938677 4:79613705-79613727 TTTCTGTTGCCATCAACAACCGG - Intergenic
977215875 4:94283167-94283189 TTTCTGCTATCAACAAAAGCTGG + Exonic
977406443 4:96605395-96605417 TTTCCCTTGTTACCAAAATTTGG + Intergenic
980115647 4:128676774-128676796 TTTCTCTTGTCCTCAAAAACTGG + Intergenic
980448260 4:132939396-132939418 TTTTTGTTTTCTCCAAAATGAGG - Intergenic
981043796 4:140247547-140247569 TTTCTGTTGTAGCAAAATTCAGG - Intergenic
981422754 4:144570409-144570431 TTTTTGTTGTCACTAGACTCTGG + Intergenic
981446606 4:144846533-144846555 TTTCTATTGTCACCAAACCCTGG - Intergenic
982302960 4:153898886-153898908 TTTCTGATGTTACCCAAATGAGG + Intergenic
984515319 4:180731663-180731685 TTTGTGTTCTCAGCAAAACCGGG - Intergenic
984860802 4:184236195-184236217 TCTCTGTGGACACCAAAATTGGG - Intergenic
987539348 5:19234251-19234273 TTTCAATTGTCACCAAAACCTGG - Intergenic
987623624 5:20368746-20368768 TTGCTGTTGGCACCAGAATTGGG - Intronic
987689724 5:21251484-21251506 TTTCTCTTATTACCAAAAACGGG + Intergenic
987739177 5:21883497-21883519 TTTCTATTGTCACCAAACCCTGG - Intronic
987948569 5:24647809-24647831 TTCCTGTTGTTACCAATATCAGG + Intergenic
988259737 5:28870514-28870536 TTTAGGTTCTCACCAAAATTTGG + Intergenic
988324476 5:29744383-29744405 TTTCTGTTGGCACCAAATGAGGG + Intergenic
992033192 5:72744689-72744711 TCTCTGTTGTTTCCAAACTCAGG - Intergenic
992642154 5:78777476-78777498 TTTATTTTGTCCCCCAAATCTGG + Exonic
994260818 5:97656467-97656489 TTTCCTTTATCACCAAAATGTGG + Intergenic
996002266 5:118378535-118378557 TTTGTGTTGTAAACACAATCTGG - Intergenic
997351124 5:133232252-133232274 TTTCTTTAGTCAACCAAATCAGG + Intronic
997816355 5:137022456-137022478 ATTATCTTGTCACCAAGATCGGG + Intronic
999788045 5:154910189-154910211 TATCTGTGATCACCAAAAACTGG - Intronic
1000111936 5:158116518-158116540 TTTCTGTTGTCAGAAAATTGAGG - Intergenic
1002814684 6:668710-668732 ATTCTGTGGATACCAAAATCTGG + Intronic
1002977384 6:2095111-2095133 ATTCTATTATCCCCAAAATCAGG + Intronic
1004291589 6:14372601-14372623 TATAAGTTGTCACCAAAAACAGG + Intergenic
1004718348 6:18241279-18241301 TTTCTGTTACCTCCAAATTCTGG - Intronic
1006502799 6:34468925-34468947 TTTCTCTCCTCACCAATATCAGG + Intronic
1007903714 6:45437609-45437631 TTTCAGTTTTCTCCAACATCAGG - Intronic
1009039055 6:58155821-58155843 TTTCTCTTCTTACCAAAAACGGG + Intergenic
1009749345 6:67863117-67863139 TTTCTGATTTCTCCAAAATTTGG + Intergenic
1010730284 6:79383455-79383477 TTTCTGTTTTAAACAAAATTAGG - Intergenic
1011432199 6:87299656-87299678 TTTCTGTTGTCACCAAAATCTGG - Intronic
1013909968 6:115263328-115263350 TTTCTGTTGGCACCTGAAGCGGG - Intergenic
1014347475 6:120292380-120292402 TTTATGTTGTCACAAATAACAGG + Intergenic
1016768416 6:147820861-147820883 TTACTTTTGTCACTAAAATCTGG + Intergenic
1016901786 6:149109900-149109922 TTTTGGTTGTCACAATAATCAGG + Intergenic
1017334186 6:153236039-153236061 TTTTTTTTTACACCAAAATCGGG + Intergenic
1018296303 6:162348422-162348444 TTTCTGTTGACCACAATATCTGG - Intronic
1018356244 6:163020898-163020920 TTGCTGTTGTCTCCAAAGCCTGG + Intronic
1021450144 7:20777280-20777302 TTTCAGATGTCACCAGAATAGGG + Intergenic
1022673262 7:32475755-32475777 TTTCTGCTGACACCAAAATGTGG + Intergenic
1022817308 7:33926135-33926157 TTTCTGTTCCCATCAAAACCTGG + Intronic
1023720268 7:43085790-43085812 TTTATATTTTCACCAAAATTGGG - Intergenic
1024756706 7:52541708-52541730 TTTCTCTTATTACCAAAAACGGG - Intergenic
1024946102 7:54808937-54808959 TTTCTCTTATTACCAAAAACGGG + Intergenic
1025557446 7:62326766-62326788 TTTGTAGTGTCACGAAAATCAGG + Intergenic
1027185096 7:75966346-75966368 TTTCTGTTTTCACCAAAGACTGG + Intronic
1027491284 7:78830605-78830627 TTTCAGTTATCTCTAAAATCAGG + Intronic
1028890351 7:95980284-95980306 TTTATGTTGGCATCAAACTCTGG + Intronic
1029933521 7:104398803-104398825 TTTCTGTTGTCACCTCCTTCTGG + Intronic
1031555331 7:123168128-123168150 TTTCTCTTTTTACCAGAATCAGG - Intronic
1033251678 7:139765985-139766007 TCTTTGTTTTCATCAAAATCTGG - Intronic
1033531801 7:142271711-142271733 TTTCTTTCATCACCAAAGTCAGG - Intergenic
1036283300 8:7419752-7419774 TTTCTATTGTCACCAAACCCTGG - Intergenic
1036338170 8:7891769-7891791 TTTCTATTGTCACCAAACCCTGG + Intergenic
1036761400 8:11511456-11511478 TTTCTGTTAACAACAAACTCTGG + Intronic
1037021061 8:13971161-13971183 CTTCTGTAGTGACCAAAATTTGG - Intergenic
1038215381 8:25557288-25557310 ATTCTATTTACACCAAAATCAGG - Intergenic
1039111413 8:34044170-34044192 TTTCTCTTATTACCAAAAACAGG - Intergenic
1039756492 8:40528892-40528914 TTTCTTTTGTGACCAGAATAAGG - Intergenic
1042230418 8:66548755-66548777 TTTATGTTTTCACAAAAATGAGG + Intergenic
1042738912 8:72020943-72020965 TTTCTCTTACCACCAAATTCAGG + Intronic
1043103679 8:76081199-76081221 ATAATGTTGTCACCATAATCAGG - Intergenic
1043829932 8:84975719-84975741 TTTGTGTTGCCACCAAATCCTGG - Intergenic
1044104918 8:88192501-88192523 CTTCTGCTGCCACCAAAATGTGG + Intronic
1044170324 8:89043431-89043453 TTTCTCTTGTTACCAAAAACGGG + Intergenic
1044838695 8:96319557-96319579 TTTATATTTTCACCAAAAACGGG + Intronic
1045066755 8:98454370-98454392 TATCTGTGGTCACCACAATAAGG - Intronic
1045072251 8:98520292-98520314 TTTATGATGTCACCAAATTGGGG - Intronic
1045116683 8:98990381-98990403 TTTCTGTTGTCAGCATACACTGG - Intergenic
1046125476 8:109901191-109901213 TTTCTCTTGTGGCCAAAGTCAGG + Intergenic
1046187829 8:110746366-110746388 TTTCTCTTATTACCAAAAACGGG + Intergenic
1046516819 8:115272940-115272962 TTTTTGTTTACAGCAAAATCGGG - Intergenic
1047454839 8:124999002-124999024 TTTCTTTTCTCACCAAGAGCAGG - Exonic
1049262754 8:141648617-141648639 TTGCTATTGTCACCATAACCAGG - Intergenic
1050646521 9:7725438-7725460 TTTTTGTATGCACCAAAATCTGG - Intergenic
1051029662 9:12658733-12658755 TGTTTGTTGCCACCCAAATCTGG + Intergenic
1051205035 9:14678730-14678752 TTTCTGTAATCACAAAAATATGG + Intronic
1051544908 9:18263034-18263056 TTACTGATGTCAGCAAACTCTGG - Intergenic
1053511848 9:38694307-38694329 TTTCTGTGTTCACAAAAAGCGGG + Intergenic
1055045215 9:71917190-71917212 TTTCTGTTCTGACCCTAATCTGG - Intronic
1055230105 9:74052838-74052860 TCCCTGTGGTAACCAAAATCTGG - Intergenic
1055977443 9:81968834-81968856 TTTCTTTCTTCTCCAAAATCTGG - Intergenic
1056903316 9:90621840-90621862 TTTTTCTTGTAACAAAAATCAGG - Intronic
1058383786 9:104409389-104409411 TTTCTGTGGTTACCAACATGTGG - Intergenic
1058549031 9:106093557-106093579 TTTCTCTTATTACCAAAAACGGG + Intergenic
1059520718 9:114939217-114939239 TTCCTGATGTTAGCAAAATCAGG + Intergenic
1186358823 X:8817120-8817142 TTTCTATAGTGACCAATATCGGG + Intergenic
1186766917 X:12780238-12780260 TTTCTGTTCCCACCAACATCAGG - Intergenic
1188122187 X:26321097-26321119 TTTTTGTTTTCCCCAAAAGCAGG + Intergenic
1188720453 X:33516865-33516887 TTGCTGTAGTCACCTATATCTGG - Intergenic
1189525852 X:41821032-41821054 TTTCTTAGGTCACAAAAATCAGG + Intronic
1191636462 X:63382996-63383018 TGTCTGTTCTCTCCAGAATCTGG + Intergenic
1193240567 X:79164355-79164377 TTTCTGCTTCCACCAAAACCAGG + Intergenic
1194646015 X:96459121-96459143 CTTCTGTAGTCACCAGAACCTGG - Intergenic
1194980113 X:100431816-100431838 ATTCAGTTGGCACCAAACTCAGG - Intergenic
1199917748 X:152362499-152362521 TTTCTGTTGTCCCTACAATAAGG - Intronic
1201463040 Y:14249061-14249083 TTGCTGTTGTCAGCAAATACTGG - Intergenic