ID: 1011437191

View in Genome Browser
Species Human (GRCh38)
Location 6:87351098-87351120
Sequence CTGTTCAAGTACATGACTCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 130}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011437188_1011437191 12 Left 1011437188 6:87351063-87351085 CCAGATGTCACAGATGAAGGTTA 0: 1
1: 0
2: 0
3: 9
4: 160
Right 1011437191 6:87351098-87351120 CTGTTCAAGTACATGACTCTAGG 0: 1
1: 0
2: 1
3: 13
4: 130

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011437191 Original CRISPR CTGTTCAAGTACATGACTCT AGG Intronic
900862568 1:5243894-5243916 CTGTCCATGAAGATGACTCTGGG - Intergenic
905893784 1:41532572-41532594 CTGTTCTAGAACATGAGCCTGGG - Intronic
906464973 1:46070224-46070246 CTACTCAAGGACATCACTCTAGG - Intronic
908073302 1:60487702-60487724 CTGTTCATGTACAAGTCTTTGGG - Intergenic
910379257 1:86608719-86608741 CAATTCTAGTACATGACTCTTGG - Intergenic
912924582 1:113902848-113902870 TTGTTCAGGTACATGACTCAAGG - Exonic
916308726 1:163370250-163370272 CATTTCAAGTACATGAGACTGGG - Intergenic
918528666 1:185492995-185493017 CTATTCTAGTACATGTCTTTTGG + Intergenic
1063475311 10:6323286-6323308 CAGTTCAAGTACAAAAGTCTGGG + Intergenic
1065880903 10:30036905-30036927 CTGGTCTAGAACATGACACTAGG - Intronic
1068256928 10:54523315-54523337 CTGTTAAAGTACACTACTTTTGG - Intronic
1071935500 10:90526190-90526212 CTGTTCCAGGACTTGAGTCTTGG - Intergenic
1072546129 10:96440969-96440991 CTCTTCAAATGCAGGACTCTTGG - Intronic
1075614026 10:123878144-123878166 TTGTTCAGGTGCCTGACTCTAGG + Intronic
1075638402 10:124046434-124046456 CTCTTGTAGAACATGACTCTGGG - Exonic
1081513152 11:43796424-43796446 CTGTATTAGTACATGATTCTGGG + Intronic
1084519170 11:69652935-69652957 CTGTCCAATCAGATGACTCTGGG - Exonic
1089227252 11:116935810-116935832 CAGCTCAAGTACATGTCTCCAGG + Intronic
1090607320 11:128434682-128434704 CTGTACAATTTCATGCCTCTGGG - Intergenic
1095997470 12:48100721-48100743 CAGTTATAGTACATGACTCTAGG + Intronic
1097018754 12:56005510-56005532 CTGTTTAAGATCATAACTCTTGG + Exonic
1097721444 12:63025930-63025952 ATGTACCAGTACATGACTTTGGG + Intergenic
1099495328 12:83339731-83339753 CAGTTCCAGGACTTGACTCTTGG + Intergenic
1100883218 12:99041087-99041109 CTGTCCAAGAACATAACACTGGG + Intronic
1111543508 13:89699723-89699745 CTATTCAAATAAATGACTCTTGG + Intergenic
1112112882 13:96322158-96322180 CTGTTCAAGAACATTATTCCAGG + Intronic
1112155879 13:96816449-96816471 CTGTCCCAGAACATGTCTCTTGG + Intronic
1112204839 13:97314637-97314659 CTGTCCAAGAACATGACTCTTGG + Intronic
1116220882 14:42085682-42085704 CAGTTCAAGAACTTGGCTCTTGG - Intergenic
1117202931 14:53411118-53411140 CAGTTCAAATACATCTCTCTAGG - Intergenic
1118624940 14:67650086-67650108 TTGATCAAGTACAAGACACTGGG + Exonic
1119653827 14:76402488-76402510 CTGTTGAATCCCATGACTCTGGG + Intronic
1120510821 14:85412322-85412344 TTGTTCAATTACATGACTCCTGG - Intergenic
1123125031 14:105940395-105940417 CTGCTGAAGAACATGGCTCTAGG - Intergenic
1129820940 15:78601569-78601591 CTGGTCATGAACATGACCCTGGG + Exonic
1130475359 15:84261449-84261471 CTGTCCAAGGACATGATGCTGGG + Intergenic
1130482776 15:84375503-84375525 CTGTCCAAGGACATGATGCTGGG + Intergenic
1133012910 16:2924861-2924883 CTGTTGAAGCACATGTGTCTTGG + Intronic
1138054517 16:53818593-53818615 ATGCTCAAGTACATTACTCAGGG + Intronic
1150898857 17:69246922-69246944 TTGTTCTAGTACATGATTTTAGG - Exonic
1151428548 17:74047349-74047371 ATGTTCAAGTACCTGGCTCAGGG - Intergenic
1152920892 17:83066102-83066124 TTGTTCAAGGAGGTGACTCTTGG - Intergenic
1155086221 18:22460922-22460944 CTGCTCAAATACATGTCTTTGGG + Intergenic
1156763152 18:40618153-40618175 ATGTTCAAGTATATGATTCATGG - Intergenic
1157971080 18:52269871-52269893 CTGTACAAGTTCAGGACTCTGGG - Intergenic
1158310277 18:56150865-56150887 CTGTTCAAATTAATCACTCTGGG - Intergenic
1159608146 18:70496353-70496375 GTGGTCCAGTACACGACTCTAGG + Intergenic
925174330 2:1771589-1771611 CTTTTCAAGGAGATGGCTCTTGG + Intergenic
928884760 2:36135589-36135611 GTATTCAAATACATTACTCTGGG + Intergenic
928923478 2:36551701-36551723 CTGTGTAAGTACATGTATCTGGG + Intronic
930153478 2:48081180-48081202 CAGTTCAGCTACATGCCTCTAGG + Intergenic
931718303 2:65047006-65047028 CTGTACAAGTCCATGACTTAGGG + Intergenic
933915185 2:86984090-86984112 CAGTTCAAGCAAATGACTATTGG + Intronic
934007808 2:87785810-87785832 CAGTTCAAGCAAATGACTATTGG - Intronic
935232717 2:101112953-101112975 CTGTTAAAGTACTTGACCCAAGG - Intronic
935771447 2:106426728-106426750 CAGTTCAAGCAAATGACTATTGG - Intronic
935995032 2:108761435-108761457 CAGTTCAAGCAAATGACTATTGG + Intronic
936130413 2:109834338-109834360 CAGTTCAAGCAAATGACTATTGG + Intronic
936214284 2:110537147-110537169 CAGTTCAAGCAAATGACTATTGG - Intronic
936423421 2:112391710-112391732 CAGTTCAAGCAAATGACTATTGG - Intronic
939048641 2:137280675-137280697 CTGATAAAGCACAAGACTCTGGG - Intronic
939081482 2:137667656-137667678 CTGTTCAAGTACAGAACTGATGG + Intronic
940341779 2:152589019-152589041 CTGATGAAGCAGATGACTCTCGG - Intronic
941842463 2:170101143-170101165 TTGTTCAAAAACATGACGCTGGG + Intergenic
941842519 2:170101922-170101944 TTGTTCAAAAACATGACGCTGGG - Intergenic
943241766 2:185393544-185393566 CTGCTCAAAAACCTGACTCTAGG + Intergenic
945412681 2:209530502-209530524 CTGTTCAGTTACATGATTATAGG + Intronic
1169819593 20:9694853-9694875 ATGTTCAAGTACGTGTCTTTTGG + Intronic
1170086936 20:12544394-12544416 CTATTCCAGGACTTGACTCTTGG - Intergenic
1172441746 20:34971047-34971069 CTGTTCATGTTAATCACTCTTGG + Intergenic
1173334181 20:42099610-42099632 CTTTTCAAATACATGACTTCAGG - Intronic
1174376759 20:50131150-50131172 CTCTCCAAGCACATGAGTCTTGG - Intronic
1174903628 20:54526654-54526676 CAGTTTAATTACATGGCTCTAGG - Intronic
1176942747 21:14943746-14943768 CTGTTCAACGACATGAAACTAGG - Intergenic
1179196976 21:39173430-39173452 CTGTTGAAAAACATGACTGTAGG - Intergenic
1184862547 22:47182087-47182109 CAGTTCTAGGACTTGACTCTTGG + Intergenic
953505642 3:43483430-43483452 CAGTTCATGTCCATGCCTCTGGG + Intronic
955384960 3:58471997-58472019 CTTTTCTAGAACTTGACTCTGGG + Intergenic
955594160 3:60570649-60570671 CTTCTGAAGTATATGACTCTGGG - Intronic
958904316 3:99925115-99925137 CTGTACCAGTATATGCCTCTTGG + Intronic
959986515 3:112579235-112579257 GTGTTTAAGTACATGACCTTAGG + Intronic
962352239 3:134664507-134664529 CTGTGCATGTACCTCACTCTGGG + Intronic
963023912 3:140899778-140899800 CTTTTAAAGTACAGGACTCAGGG + Intergenic
965168470 3:165228059-165228081 CTCGTCAAGTACATCAGTCTTGG + Intergenic
965855431 3:173082348-173082370 CTGTGCAGGAACATGACTGTGGG + Intronic
968429144 4:544986-545008 CAGTTCCAGAACTTGACTCTTGG - Intergenic
968982253 4:3856652-3856674 CTGTCCATGCACATGGCTCTAGG + Intergenic
970114636 4:12680698-12680720 TTCTTCAAGTACAGGATTCTGGG - Intergenic
972092545 4:35305338-35305360 TTTTTCTAGAACATGACTCTGGG - Intergenic
975035077 4:69669651-69669673 TGGTTCAAGGACTTGACTCTTGG + Intergenic
975421576 4:74170680-74170702 CTGATAAAGGACATGAATCTAGG + Intronic
975895221 4:79081504-79081526 CTTTTCAAGTGCATGACTGTTGG + Intergenic
979292534 4:118993587-118993609 CTCTTCAAGCACAAGTCTCTTGG + Intronic
979824502 4:125216576-125216598 CTGCTCAATTACAGGACACTGGG + Intergenic
980499696 4:133632601-133632623 CTGTTCTAGTCCCTGACTGTTGG - Intergenic
981227326 4:142312671-142312693 CCATTCAAGCACATGACTCCAGG - Intronic
981329226 4:143488757-143488779 CAGTTCTAGGACATAACTCTTGG + Intergenic
985319898 4:188699168-188699190 ATGTTCAGGTACCTGAATCTGGG + Intergenic
988662559 5:33288150-33288172 CAGTTTAAGTACATGACTATAGG + Intergenic
988705337 5:33720912-33720934 ATGTTCTAGTACATGTCTTTTGG - Intronic
991205270 5:64042479-64042501 CAGTTCCAGAACATGACTCCTGG + Intergenic
991367166 5:65880942-65880964 CTGATACAGTACATTACTCTAGG + Intergenic
992619504 5:78578672-78578694 TTGGTAAAGTACATGTCTCTAGG - Intronic
993162000 5:84303768-84303790 CTGTTCAAGTTGATGCCTCCGGG - Intronic
998390558 5:141784523-141784545 CTCTTCCAGTCCCTGACTCTGGG + Intergenic
999832781 5:155336751-155336773 CTGTTAAAGTACAAGTCTCATGG + Intergenic
1000046433 5:157525530-157525552 ATGTTCAGGTTCATGACTCTGGG + Intronic
1001145825 5:169183568-169183590 CTGGTCCATGACATGACTCTAGG + Intronic
1003752387 6:9074121-9074143 TTATTCAAATAAATGACTCTTGG - Intergenic
1005599218 6:27409569-27409591 CTGTACAAATACTTGACACTTGG - Intergenic
1010843785 6:80679961-80679983 CTGCTCAAGAACAGGACTCATGG + Intergenic
1011437191 6:87351098-87351120 CTGTTCAAGTACATGACTCTAGG + Intronic
1015369267 6:132432960-132432982 CTGTGGAGGTACATGACTCTGGG - Intergenic
1015891973 6:137978460-137978482 CTTTTCAAGCACATACCTCTAGG - Intergenic
1016670629 6:146702151-146702173 CTGTTCTAGGATATGAATCTAGG + Intronic
1019892423 7:3956816-3956838 CTGAGCAAGTGCATGGCTCTGGG - Intronic
1020714690 7:11657026-11657048 CTCTTCAAGATCATGACTGTAGG - Intronic
1022763885 7:33388200-33388222 ATATTCTGGTACATGACTCTAGG - Intronic
1030008060 7:105137873-105137895 GTGGTCAAGTGCAAGACTCTAGG + Intronic
1033423436 7:141222392-141222414 CTGTCTAGGTATATGACTCTTGG + Intronic
1033882462 7:145902467-145902489 CAGTTAAAGAACTTGACTCTTGG - Intergenic
1034286050 7:149883687-149883709 CTGCTCAAGCCTATGACTCTAGG - Intergenic
1035897246 8:3416938-3416960 CTGTTCATATACATGACTATGGG - Intronic
1037419990 8:18691854-18691876 CAGTCGAAGTACATGACCCTAGG + Intronic
1037731270 8:21525719-21525741 CTTTTCAAGTTCAAGACCCTGGG - Intergenic
1038947519 8:32377551-32377573 CTGTTTTGGTTCATGACTCTGGG - Intronic
1041461932 8:58120729-58120751 CATTTAAAGTACATGCCTCTGGG + Intronic
1044989215 8:97780571-97780593 CTAGTAAAGTACATGACACTTGG - Intronic
1045077014 8:98581231-98581253 CAGTACCAGTACAGGACTCTGGG - Intronic
1055886457 9:81069348-81069370 CTGTTCAAGTCCAAGAGCCTAGG + Intergenic
1059586846 9:115616437-115616459 CTATTCTTGTACATGACCCTTGG - Intergenic
1191083417 X:56538118-56538140 CAGTTCTAGGACTTGACTCTTGG + Intergenic
1192532765 X:71903327-71903349 CTGTCCAAGGTGATGACTCTGGG + Intergenic
1192534705 X:71917492-71917514 CTCTTTGAGTACTTGACTCTGGG + Intergenic
1192822392 X:74658543-74658565 CAGTTCCAGCACCTGACTCTTGG - Intergenic
1193876573 X:86869157-86869179 CAATTCTAGTACTTGACTCTTGG - Intergenic
1195278049 X:103301660-103301682 CTTTTCATGTTCATGACTGTTGG + Intergenic
1195834879 X:109102871-109102893 CTATTCCAGGACTTGACTCTTGG - Intergenic
1196089983 X:111730032-111730054 CTGATTAACTACATGACTTTAGG - Intronic
1196194400 X:112824725-112824747 CAGTTCAAGTACAGGAGTCCTGG - Intronic
1196538945 X:116882611-116882633 CAGTTCCAGGACGTGACTCTTGG - Intergenic
1198478002 X:137014472-137014494 CTGTTTTACTACATGATTCTGGG + Intergenic
1199791808 X:151161888-151161910 CTGTTAAAGTGAATGACTCATGG + Intergenic
1201770004 Y:17610308-17610330 CTGGTCATGCACATGACTCTCGG - Intergenic
1201831550 Y:18295679-18295701 CTGGTCATGCACATGACTCTCGG + Intergenic