ID: 1011440306

View in Genome Browser
Species Human (GRCh38)
Location 6:87380355-87380377
Sequence TCAATGCAGGGCCTACATGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011440301_1011440306 17 Left 1011440301 6:87380315-87380337 CCAGAAAGAGCATGAAGGTAAGG No data
Right 1011440306 6:87380355-87380377 TCAATGCAGGGCCTACATGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011440306 Original CRISPR TCAATGCAGGGCCTACATGC AGG Intronic