ID: 1011445342

View in Genome Browser
Species Human (GRCh38)
Location 6:87433146-87433168
Sequence CTGAATAAAATGAGGCAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 391
Summary {0: 1, 1: 0, 2: 4, 3: 37, 4: 349}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011445342 Original CRISPR CTGAATAAAATGAGGCAGCA AGG (reversed) Intronic
900966196 1:5960460-5960482 CTGAAGAAAAGGATGCAGCTCGG - Intronic
902169267 1:14597917-14597939 ATGGGTAAACTGAGGCAGCAGGG + Intergenic
903457680 1:23499206-23499228 CTCCATAAAATGAGGGGGCATGG + Intergenic
904113190 1:28142879-28142901 CTGAGTCTAATGAGGCTGCAGGG + Intergenic
904856060 1:33499083-33499105 CAGAACAAGATGAGGCAGGACGG - Intergenic
906190077 1:43893243-43893265 CTGAATAACTGGAGGCTGCAGGG - Intronic
907004097 1:50893181-50893203 ATGAGTTAAATGAGGCACCAGGG - Intronic
908243901 1:62212486-62212508 AAGAATGAAATGAGGCAGCCAGG + Intergenic
908334384 1:63105594-63105616 AGGAATTAAATGAGACAGCATGG + Intergenic
908930209 1:69308929-69308951 CTGAATAAAATGAGTTAGGGAGG + Intergenic
909313138 1:74179263-74179285 CAGAAAAAAACGAGGAAGCATGG - Intronic
909989588 1:82206747-82206769 CTGTATAAAGTGAGGCCGCCAGG - Intergenic
910004885 1:82384051-82384073 GTGACTAAGATGAGGCAGCTGGG + Intergenic
911315722 1:96354511-96354533 CTGAATGAGATGAGGCAGCATGG - Intergenic
911432824 1:97814129-97814151 CTGAATAGCAAGAAGCAGCAAGG + Intronic
911709836 1:101057827-101057849 CAGAATGCAAAGAGGCAGCAAGG - Intergenic
912438946 1:109683555-109683577 ATGAATAAAATGATGCTTCAAGG - Intronic
912441468 1:109702000-109702022 ATGAATAAAATGATGCTTCAAGG - Intronic
913310042 1:117480614-117480636 AGTAAAAAAATGAGGCAGCATGG - Intronic
918139168 1:181705842-181705864 ATGAAGAAATTGAGACAGCAAGG + Intronic
919599956 1:199610413-199610435 GTGAATAAAAGGAGGTAGGAGGG - Intergenic
919641889 1:200053430-200053452 ATGAAGAAACTGAGGCAGAAGGG + Intronic
920101946 1:203522226-203522248 CTGATTAAAATGCTGCAGCAGGG + Intergenic
920454133 1:206085069-206085091 TTGAAGAAACTGAGGCAGCAAGG - Intronic
921350245 1:214227341-214227363 CTGAATAAAGTGGAGCAGCCTGG - Intergenic
922077998 1:222266885-222266907 ATGACAAAAATGAGTCAGCAGGG - Intergenic
922124487 1:222709496-222709518 ATGAAAAAAATGAAGCAGGATGG + Intronic
922650893 1:227337381-227337403 CTGAATAAAGACATGCAGCAAGG + Intergenic
922671033 1:227508915-227508937 ATGAAGAAAATGAGGCCACACGG - Intergenic
922844056 1:228668972-228668994 CTGAATGAAAAGGGGCAGGATGG + Intergenic
924011305 1:239667984-239668006 CTTAATAAAATTAGGTAGCATGG - Intronic
1063577827 10:7277962-7277984 CTGAATAAACTGCGGAAACAGGG - Intronic
1064761806 10:18628670-18628692 CTGAATGAAATGAAGCAAGAAGG + Intronic
1067571376 10:47373824-47373846 CTGAATAAACGCAGGCAGCATGG + Intronic
1068245763 10:54364999-54365021 CTGGATAAGATGAGGCATAAGGG - Intronic
1068778148 10:60890044-60890066 CTGAGGAAACTGAGGCAGAAAGG + Intronic
1068801478 10:61145447-61145469 CTGAATAAAATGAGTAAAAAGGG + Intergenic
1069888155 10:71636851-71636873 CAGAGGAAAAAGAGGCAGCAGGG + Intronic
1070514097 10:77187633-77187655 CTCAATAATATGAGGGGGCAGGG + Intronic
1073992872 10:109283629-109283651 CTCAATAAAACAATGCAGCAGGG - Intergenic
1074416017 10:113267364-113267386 CTGAATAAACTGAAACAGGAAGG - Intergenic
1075563166 10:123483045-123483067 CTGAATCAAAGGAAGCAGAAAGG - Intergenic
1076121104 10:127937141-127937163 ATGAATAAAATGATGCAGCTAGG - Intronic
1077791254 11:5442477-5442499 CTGAAGGAAAAGAGGCAGAAAGG - Intronic
1078290735 11:10007713-10007735 TTGAATATAATGAGGTAGAAGGG - Intronic
1078400924 11:11026286-11026308 TGGGAGAAAATGAGGCAGCATGG + Intergenic
1078671606 11:13370639-13370661 CTGAGTGAAAGTAGGCAGCATGG - Intronic
1078938922 11:15978446-15978468 GTGAATAAAATGTTTCAGCAAGG - Intronic
1081442864 11:43099725-43099747 ATGAATAAAATGAAGCAAGAAGG - Intergenic
1081724809 11:45320869-45320891 CTGGAGAAGCTGAGGCAGCATGG + Intergenic
1081797529 11:45831722-45831744 CTGAAGAAAATGAAACAGGATGG + Intergenic
1082596288 11:55085784-55085806 ATGAATAAAATGAAGCAAGAAGG + Intergenic
1082806068 11:57451572-57451594 CTGTGTAAAATTAGGCAGGAGGG + Intergenic
1084176096 11:67423121-67423143 CTGAAGAATATGAGTCAGCCAGG - Intronic
1085136451 11:74093495-74093517 CTGAACTAAATAAGGCAGTAAGG + Intronic
1085309792 11:75509399-75509421 CTGGATAAAATGTACCAGCAGGG + Intronic
1085331223 11:75653015-75653037 GAGAAAAAAATGAGGCATCATGG - Intronic
1086068913 11:82777008-82777030 GTGAACTAAATAAGGCAGCAGGG + Intergenic
1087335817 11:96843004-96843026 CTGAAGTCAATGAGGGAGCATGG - Intergenic
1088222726 11:107586972-107586994 CTCAATAAAATGAGGAAAAAAGG - Intergenic
1091494881 12:963946-963968 CTGAATGAAATGAGTGAGAAGGG + Intronic
1093552496 12:20431206-20431228 CAGAATGAAATGAGGCTGTAGGG + Intronic
1094390691 12:29947052-29947074 ATGAATGAAATGAGGAAGGAAGG + Intergenic
1095602169 12:44026297-44026319 CAGAAAAAAATGTGGCAGCAGGG - Intronic
1097442477 12:59627736-59627758 CTGAAAAAAATGAGTAAGAAAGG - Intronic
1097514871 12:60592802-60592824 CTAAATGAAATGTGGGAGCAAGG + Intergenic
1097718325 12:62992413-62992435 TAGAAAAAAATGAGCCAGCATGG - Intergenic
1098060480 12:66555560-66555582 CTGAATAACATAAGGCACCAGGG + Intronic
1098298599 12:69029647-69029669 TTAAAAAAAATTAGGCAGCATGG + Intergenic
1098528518 12:71513850-71513872 CTGAAGCAACTGAGGCAGTATGG + Intronic
1099381594 12:81960670-81960692 CGGAATAAAAAGAAACAGCAAGG - Intergenic
1101588785 12:106108368-106108390 CTGGATAGAAGGAGGCTGCATGG + Intronic
1102462448 12:113108273-113108295 CTGCGTAAACTGAGGCAGCAAGG + Intronic
1102742231 12:115217900-115217922 CTTCCTAAAATGTGGCAGCATGG - Intergenic
1102854613 12:116282567-116282589 CTGACTAACAGGAAGCAGCAAGG + Intergenic
1104112975 12:125721522-125721544 TTTGATAAAATGAGGCAGAAAGG + Intergenic
1105487657 13:20852684-20852706 CAGAATCAAATGAGAAAGCAAGG + Intronic
1106592674 13:31110805-31110827 CTCTATAAAATGAGCCAGCTCGG - Intergenic
1106639107 13:31564400-31564422 CTGAATAAGATGAGGGACCCAGG + Intergenic
1107476035 13:40736196-40736218 ATGAATGAAATGAAGCAGGAAGG + Intronic
1107616745 13:42176696-42176718 CTGAATAAACTGAGGCTGATTGG + Intronic
1107754207 13:43601178-43601200 ATGAATTAAATAAGGCACCAGGG + Intronic
1107973616 13:45668791-45668813 ATGAATGAAATGAAGCAACAAGG - Intergenic
1108259239 13:48640526-48640548 TTGATTGGAATGAGGCAGCAAGG + Intergenic
1109732763 13:66437550-66437572 CTCAATAAAATTAGCCATCAAGG + Intronic
1110448616 13:75616897-75616919 CTAAACCAAATGAGGCACCAGGG - Intergenic
1110680900 13:78310613-78310635 CTGAATAAAATCAGAAAACAGGG + Intergenic
1111256432 13:85675728-85675750 CTGATTATACTGAGACAGCAGGG - Intergenic
1111966738 13:94869024-94869046 CTGAATTAACTGAGACAGCAAGG + Intergenic
1112188377 13:97150156-97150178 CAGAATAAAAGGAATCAGCAAGG + Intergenic
1113072799 13:106438149-106438171 CTAATTAAAATTAGGCTGCACGG - Intergenic
1113097178 13:106678320-106678342 CTGATGAAGATGAGGCAGGATGG + Intergenic
1113706376 13:112435806-112435828 ATGAGGAAACTGAGGCAGCAAGG + Intergenic
1114143712 14:19948126-19948148 CTGAAAAAAATGAGTCTGCACGG - Intergenic
1114580315 14:23751854-23751876 CTTAAAAAAATGTGGCAGCAGGG + Intergenic
1115493246 14:33979191-33979213 CTGGATGAAATGAGGCCCCAGGG - Intronic
1115620177 14:35133506-35133528 ATGAACTAAATAAGGCAGCAGGG - Intronic
1115833344 14:37367521-37367543 CTGAAGAAAAAGAGGAAGCATGG - Intronic
1119075108 14:71629952-71629974 CACAATAAAATAACGCAGCAAGG - Intronic
1119801605 14:77450232-77450254 CTAAATAAAATGAGGCACAAAGG - Intronic
1119948635 14:78721380-78721402 AAGAATAAAATGAGGCAGTTGGG + Intronic
1120227224 14:81804384-81804406 ATGAAGAAAATGAGGCATAAAGG - Intergenic
1121318446 14:92975902-92975924 CTGACTATCATGAGACAGCATGG - Intronic
1124116454 15:26847739-26847761 CTGAGCCAAATGAGACAGCAAGG - Intronic
1125987839 15:44072827-44072849 CTGAATAAAATGAAAGATCAAGG + Intronic
1126238291 15:46410830-46410852 CTGAGAAAAATGAGGCAACATGG - Intergenic
1128254224 15:66185251-66185273 CTGCAGAACTTGAGGCAGCAGGG - Intronic
1128791336 15:70436502-70436524 TTTAAAAAAATGAGGCATCAAGG + Intergenic
1129739019 15:77981005-77981027 ATGAATAAAAGCAGGCCGCATGG + Intergenic
1129846936 15:78772170-78772192 ATGAATAAAAGCAGGCCGCATGG - Intronic
1129924518 15:79351044-79351066 CTCAATAAAATGAGGAGTCATGG + Intronic
1130261873 15:82360827-82360849 ATTTATAAAAAGAGGCAGCATGG - Intergenic
1130279362 15:82508184-82508206 ATTTATAAAAAGAGGCAGCATGG + Intergenic
1130742137 15:86612351-86612373 CTGAATAAACTTAGGCTGAATGG + Intronic
1132114037 15:99122959-99122981 CTAACTAAAATGAGTCAACAAGG - Intronic
1133123270 16:3625468-3625490 TTAAATAAAATTAGCCAGCATGG + Intronic
1133893376 16:9902827-9902849 CTGAAGAGGATGAGGCAGAAAGG - Intronic
1134527661 16:14956809-14956831 ATAAATAAAACGAGGCACCAGGG + Intergenic
1135585265 16:23665461-23665483 CTGACGAGAAGGAGGCAGCAAGG - Intronic
1137714688 16:50591582-50591604 CTGTACAAAAAGAGGAAGCATGG - Intronic
1141670320 16:85488194-85488216 AAGAAGAAGATGAGGCAGCAGGG - Intergenic
1142739576 17:1923322-1923344 CTGAAAAAAAGAAAGCAGCAGGG - Intergenic
1143210561 17:5184203-5184225 CTGAAGAAAAGAAGTCAGCAAGG - Exonic
1144374241 17:14623205-14623227 TTGAAAAAAATGAGGAAGTAAGG - Intergenic
1146330847 17:31925782-31925804 CTCACTAAAATGTGGCAACAGGG + Intergenic
1146533724 17:33632005-33632027 TTGCAGAAAAGGAGGCAGCATGG + Intronic
1146999196 17:37348353-37348375 ATGAATAAAAAGAGACACCAAGG + Intronic
1148003221 17:44403067-44403089 ATAAATAAAATTAGCCAGCATGG - Intronic
1148416932 17:47513996-47514018 ATGAATAAACTGAAACAGCAAGG + Intergenic
1148443865 17:47726090-47726112 CTCTGTAAAATGAGACAGCAAGG - Intergenic
1150203911 17:63385990-63386012 CTTGATAAAATGAGGAAGGATGG - Intronic
1150264410 17:63822907-63822929 ATGAGGAAACTGAGGCAGCAAGG + Intronic
1150897693 17:69233560-69233582 CTGGACAAAATGAGGCACCAGGG - Intronic
1152262427 17:79274298-79274320 ATGAGGAAACTGAGGCAGCAAGG - Intronic
1152909515 17:82991706-82991728 ATGAACTAAATGAGGCACCAGGG + Intronic
1154170903 18:12049203-12049225 CTGTTTAAAATGAGGCAGTTTGG - Intergenic
1154284442 18:13039153-13039175 GTGATGAAAAGGAGGCAGCAGGG + Intronic
1154461680 18:14596175-14596197 CTGAAAAAAATGAGTCTGCAAGG - Intergenic
1155282295 18:24251718-24251740 ATGAACTAAATAAGGCAGCAGGG + Intronic
1155468252 18:26163266-26163288 GTGAGTAAAATGAGACAACAGGG + Intronic
1155596338 18:27492355-27492377 TAGAACGAAATGAGGCAGCATGG - Intergenic
1156819456 18:41355082-41355104 CTGATAGAAATGAGACAGCATGG - Intergenic
1157108046 18:44793222-44793244 ATCTATAAAATGAGGCAGCTGGG + Intronic
1157629753 18:49082451-49082473 CTGAATAAAATAATGCAGTGTGG - Intronic
1157696447 18:49727461-49727483 GTAAATGAAATGAGGCACCAAGG - Intergenic
1159896336 18:74000646-74000668 ATGAATTAAATAAGGCACCAAGG - Intergenic
1162550010 19:11353454-11353476 CTGACCAAGATGAAGCAGCAGGG + Exonic
1163504483 19:17697316-17697338 GGGAATGAAATGAGGCACCAGGG - Intergenic
1163528579 19:17836169-17836191 CTGTATGAACAGAGGCAGCAGGG - Intronic
1165380472 19:35476044-35476066 CTGGATGAAGTGAGGGAGCAAGG + Intergenic
925953119 2:8934735-8934757 GAGAATAAAATGTGGCAGCAAGG - Intronic
926106084 2:10152363-10152385 CTGAATAAAATGAAAAAGAAGGG - Intronic
926796276 2:16621691-16621713 CTGGAGAAAGTGAGGGAGCAAGG - Intronic
928877792 2:36061227-36061249 CTGAATAAAAGGAGCCTCCAGGG - Intergenic
929847209 2:45542177-45542199 CTGAACAGGCTGAGGCAGCAGGG + Intronic
930003176 2:46874958-46874980 CTGGATAAACTGAGGCAGGAAGG + Intergenic
930298135 2:49580576-49580598 ATGAATATAATGAGGGAGAAAGG + Intergenic
930662841 2:54072288-54072310 ATAAATAAAATAAGGCAGCTAGG - Intronic
931303969 2:61010195-61010217 CTGAAAAAAATGTGTAAGCAGGG + Intronic
931527067 2:63168395-63168417 CTAAATAAAATGATTCAGAAAGG - Intronic
932946783 2:76243195-76243217 CTGTATAAAATGGGGGTGCAGGG + Intergenic
933391962 2:81682004-81682026 TAGTATAAAATGAGTCAGCAGGG + Intergenic
933503223 2:83143204-83143226 CTAAATATAATGTGGCATCATGG + Intergenic
933576388 2:84073511-84073533 CTGACTATGCTGAGGCAGCAAGG + Intergenic
934870735 2:97862374-97862396 ATGAATTAAATAAGGCACCAGGG + Intronic
935356446 2:102206241-102206263 ATGAATTAAATAAGGCACCAGGG - Intronic
935598783 2:104901124-104901146 TTTCATAAAATGAGACAGCAAGG + Intergenic
935904055 2:107824347-107824369 CTGAACAAAATGAGGCTGGAAGG - Intergenic
937427123 2:121809344-121809366 CTGAAAAAAATGAGGAAACCCGG - Intergenic
939163947 2:138620333-138620355 CTGAATGAAAAGAGGCAAGAGGG + Intergenic
939728061 2:145748096-145748118 ATGAAAAAAATGAGGCAGAAAGG + Intergenic
940033618 2:149290372-149290394 CTGATTAAAATGAATCTGCAAGG + Intergenic
940207182 2:151216090-151216112 CTGATTGAAAAGAGGCAGTAGGG + Intergenic
940208360 2:151229774-151229796 ATAAATAAAATGAGGAGGCAAGG + Intergenic
940704843 2:157091762-157091784 TTGAATAAATTGAGGAATCAAGG - Intergenic
941450992 2:165659807-165659829 CAGAATAAAGTCAGTCAGCAGGG + Intronic
941639123 2:167968682-167968704 CTGAATAGATTGATGCAGAAAGG + Intronic
942151761 2:173082702-173082724 TTGAATAAAGTGAGGGTGCACGG - Intronic
943820040 2:192310732-192310754 CTGAACAATATGATGCAACATGG + Intergenic
944247958 2:197551885-197551907 CTGATTGTAATGAGGCAGTAAGG + Exonic
944722361 2:202436937-202436959 GTGAATAAAATGGGAAAGCATGG - Intronic
944819326 2:203414003-203414025 CTGAAGAGGATGAGGCAGGAAGG - Intronic
945804524 2:214474264-214474286 CTGAAAGCAAAGAGGCAGCATGG + Intronic
946848318 2:223880843-223880865 TTGAATAAAATCATACAGCATGG + Intronic
947109240 2:226700564-226700586 GTGAATATTATGAGGCAGCGTGG + Intergenic
947709214 2:232301386-232301408 CTGAATAAAATTAAACAGCCTGG - Intronic
948148573 2:235727091-235727113 CTGACTCAAATGAGGCCACATGG - Intronic
948304286 2:236935235-236935257 CAGAAGAAAAGGAGGCTGCAGGG + Intergenic
1169689580 20:8315591-8315613 ATGTATAAAATGAGGGAGGAAGG + Intronic
1170834423 20:19871460-19871482 CCTACTAAAATGAGGGAGCAGGG + Intergenic
1172230213 20:33331347-33331369 CTGCACAAAAGGAGGCAGCAGGG + Intergenic
1173813248 20:45969093-45969115 ATGAAAAATATGAGGCACCAAGG - Intronic
1174720839 20:52810580-52810602 CTTATTAAAATGAGGCAGTAGGG + Intergenic
1175602503 20:60286508-60286530 CTGCAGATAATGATGCAGCAAGG + Intergenic
1177590262 21:23154857-23154879 CTGAATCAGAAGAGGCAGCAGGG + Intergenic
1178011570 21:28292324-28292346 CTGAAGAGACTGAAGCAGCAGGG - Intergenic
1178754603 21:35336685-35336707 CTGAAATCAATGAGTCAGCAGGG - Intronic
1179652665 21:42821767-42821789 ATGAACTAAATAAGGCAGCAGGG + Intergenic
1179875268 21:44263663-44263685 CTGAATAAAATGTGGCTCCTTGG + Intergenic
1182026553 22:27123707-27123729 CTGAAGAAAGGGAGGCAGAAAGG + Intergenic
1183523636 22:38310895-38310917 TTGAATAAATGGAGCCAGCAAGG + Intronic
1183870717 22:40739963-40739985 CAGAACCAAATGAGGCAGGAAGG - Intergenic
949156025 3:827988-828010 ATGAACAAAATAAGGCACCAGGG + Intergenic
949585978 3:5437629-5437651 CTGCATAAGATGAAGAAGCATGG - Intergenic
949712898 3:6892234-6892256 ATGAATGATATGAGGAAGCAAGG + Intronic
950527025 3:13530226-13530248 CTGAGAAAACTGAGGCAGAAAGG - Intergenic
950856361 3:16109396-16109418 CTGACAAATCTGAGGCAGCAGGG + Intergenic
951246705 3:20349780-20349802 CTGAATCAAAGGAGGGTGCAGGG - Intergenic
951692913 3:25416067-25416089 CTGAAGAAAAAGATGCAACAAGG + Intronic
951865942 3:27307740-27307762 CTGAATATGATGAGTCAGCTTGG - Intronic
952008728 3:28874945-28874967 ATGAACAAAATAAGGCACCAGGG - Intergenic
952724191 3:36565428-36565450 CAGAATAAAATGAGGGAACTTGG - Intergenic
954962621 3:54579650-54579672 CTAAACCAAATGAGTCAGCAAGG + Intronic
958735701 3:98007231-98007253 CTGACTGAAATGAGGGAGAAGGG + Intronic
960226325 3:115173654-115173676 CTGAATATAATGTGGCATCCTGG + Intergenic
960791022 3:121430974-121430996 CTGCAGAGAATGAGGCAGAAGGG + Intergenic
961400572 3:126639224-126639246 CTGAATCAAATGCTGCAGAAAGG - Intronic
962729865 3:138271675-138271697 CATAATAATGTGAGGCAGCATGG - Intronic
964687495 3:159413285-159413307 CAGAGCAAAATGAGGCTGCAGGG + Intronic
967090132 3:186127945-186127967 CTGAAGTTTATGAGGCAGCATGG + Intronic
968855432 4:3116861-3116883 TTGCTTAAAATGAGGCTGCATGG - Intronic
969601482 4:8179123-8179145 TAGAATAAAAGGAGGCGGCAGGG + Intergenic
970272040 4:14358449-14358471 CTTAACAACATGTGGCAGCATGG - Intergenic
971769458 4:30877919-30877941 CAAAATAAAATAAGGCACCATGG - Intronic
972016041 4:34247328-34247350 CTGAGTAAACTGAGACAGTAAGG + Intergenic
972060054 4:34858459-34858481 CTGATTCAGATGAGGCAACAAGG + Intergenic
972856680 4:43115170-43115192 ATGAATTAAATAAGGCACCAGGG + Intergenic
973611863 4:52643659-52643681 CTGAATAAACTTGGGAAGCAGGG + Intronic
974893103 4:67906327-67906349 ATGAACAAAATAAGGCACCAGGG - Intergenic
977011213 4:91636001-91636023 CTGAATAAGAGGAGACAGCTAGG + Intergenic
977814216 4:101395347-101395369 ATGAATAGAATGATGCAGTATGG + Intergenic
978023359 4:103841347-103841369 ATGAAAAAAACAAGGCAGCAGGG + Intergenic
978071748 4:104481040-104481062 CAGAATCACATGAGGTAGCAAGG + Intronic
978181985 4:105809429-105809451 CTGAATAAAGTGAGAGAGTAAGG - Intronic
978497623 4:109377057-109377079 GTGAAGAAAATGAGACAGAAAGG - Intergenic
978499160 4:109390157-109390179 ATGATTAAAATGAGGTAGAAAGG + Intergenic
981716821 4:147760139-147760161 CTGAATACAGGGAAGCAGCAAGG - Intronic
982045735 4:151443840-151443862 CTGAACCAACTGTGGCAGCAGGG - Intronic
982108630 4:152033179-152033201 CTAAATGCAATGAGGAAGCATGG + Intergenic
982207342 4:153006470-153006492 CTGAGAAAAATGAGGCTGGAAGG + Intergenic
982918932 4:161249955-161249977 CGGAAGAAGCTGAGGCAGCAGGG + Intergenic
983279667 4:165664810-165664832 CTGAATAGACTGAGGGACCATGG + Intergenic
984833700 4:183999704-183999726 CTCGATGAAATCAGGCAGCAGGG - Intronic
987332408 5:16868964-16868986 CTGAATGAAATAAGAAAGCATGG + Intronic
988424382 5:31046497-31046519 TTGAATGAAATGAGGGAGCTTGG - Intergenic
988780517 5:34516934-34516956 CTGAAGGAAATGAGGCAGCAAGG - Intergenic
989015465 5:36926606-36926628 GTGAATAAAATGCAGCAGAAAGG - Intronic
990071886 5:51792194-51792216 CTTCATAAAATGAGTTAGCAAGG - Intergenic
992027515 5:72685082-72685104 CTGTATAAAATAAAGAAGCAAGG + Intergenic
992240956 5:74768741-74768763 TTGAATGATATGAGGCATCAGGG - Intronic
992803618 5:80315542-80315564 CCAAATAAACTGAGGCAGAAAGG - Intergenic
993193926 5:84715871-84715893 ATGAACAAGATGAGGCAGGAAGG - Intergenic
993564922 5:89461943-89461965 ATCAATAAAATGAGGCTGGAAGG - Intergenic
994538367 5:101060487-101060509 ATGAATGAAATGAAGCAGGAAGG - Intergenic
994616038 5:102106280-102106302 CTGAATGAACTAAGGCATCAGGG - Intergenic
994839123 5:104898534-104898556 CTAAATACAATGAGCTAGCAAGG - Intergenic
994975549 5:106800008-106800030 CTGAATAAGATGAGGAAGAGAGG - Intergenic
995445334 5:112236448-112236470 ATGAGGAAAATGAGGCTGCAAGG - Intronic
996773264 5:127107829-127107851 ATGAATAAAATGAAGCAGGAAGG - Intergenic
996937296 5:128964279-128964301 CTGCAGAACATGAGGCAGAAGGG + Intronic
998534935 5:142920949-142920971 CTCAATAAAATAAGGAAGGAAGG - Intronic
998609085 5:143668358-143668380 CTGAATAAACGGGGGCAGAAAGG - Intergenic
999040927 5:148411055-148411077 GTGAAAAAAATGAAGCAGAATGG - Intronic
999065544 5:148682003-148682025 CTGTACAAAAACAGGCAGCAGGG - Intergenic
999228837 5:150049465-150049487 CTGAAGCACATGAGTCAGCAGGG + Intronic
1000130363 5:158291273-158291295 CAGAGAAAAAAGAGGCAGCAAGG + Intergenic
1000147189 5:158464995-158465017 CTCAGTCAAATGAGGCAGGAAGG - Intergenic
1000598171 5:163239778-163239800 CCTAATAAAATGAGTCAGCGAGG - Intergenic
1001425028 5:171617322-171617344 CTGAATAAAATCTGTCTGCACGG + Intergenic
1002355815 5:178627689-178627711 TTGAATAAAATCAGCCCGCAGGG - Intronic
1002816367 6:684910-684932 CTGAACAAAATGAGTGATCACGG + Intronic
1002934982 6:1663750-1663772 ATGAAGGAAATGAGGGAGCAGGG - Intronic
1003077706 6:2997974-2997996 CTGAATAAAATGAACCATCATGG - Intronic
1003085513 6:3057011-3057033 CTGAATAAAATGAACCATCATGG + Intergenic
1004984914 6:21070586-21070608 CTGAAAAAAATGAGGACACAGGG - Intronic
1007783433 6:44266909-44266931 ATGAATAAAATGAGGTTGCAGGG - Intergenic
1007836894 6:44680945-44680967 CCAAACAAAATGAGGCATCAAGG - Intergenic
1008391529 6:50957690-50957712 CTGAATTGAATGCTGCAGCAGGG - Intergenic
1011445342 6:87433146-87433168 CTGAATAAAATGAGGCAGCAAGG - Intronic
1011820024 6:91242459-91242481 CTGTATAAAATTATGCTGCAAGG - Intergenic
1012089410 6:94873009-94873031 ATGAATAAAATGAAGCAAGAAGG - Intergenic
1013551698 6:111213956-111213978 CTGAATAAAAGAAGGCATCTTGG - Intronic
1013842068 6:114408238-114408260 TTGAAGAAAATAAGGAAGCAGGG - Intergenic
1014415119 6:121174414-121174436 CTGAATCAAAAGAGTCAGCACGG + Intronic
1014541192 6:122678300-122678322 CTGAATGAAAAGAGGCAGGAGGG + Intronic
1014759203 6:125337194-125337216 TTGAAAAAAAAGAGGAAGCAAGG + Intergenic
1014956141 6:127618785-127618807 CTGAATAAAGTGGGGCATTACGG + Intergenic
1015545946 6:134361431-134361453 GAGAAGAAAATGAGGAAGCAAGG - Intergenic
1015670795 6:135687569-135687591 GTGAACAGAATGAGGCTGCAAGG - Intergenic
1015991241 6:138945620-138945642 CTGAAGAATATGAGGCTGCATGG + Exonic
1017269675 6:152491527-152491549 CAGAAGAAAATAAGGCAGTAAGG - Intronic
1020478122 7:8623158-8623180 CTGAATTTAATGATGCAGGAGGG + Intronic
1021305738 7:19029638-19029660 CTGAATAATATCTAGCAGCAGGG - Intronic
1022488812 7:30800944-30800966 CTGAATTAAATTATGCAACAAGG - Intronic
1022865037 7:34408986-34409008 CTGTATGCATTGAGGCAGCAGGG + Intergenic
1023763858 7:43492435-43492457 CTGAATAGAATAAGGAAGAAAGG - Intronic
1024294085 7:47829015-47829037 CTGAATAAAAGAAGGAAGAAAGG + Intronic
1025000250 7:55310007-55310029 CTGAATAAAATGTAGACGCAAGG + Intergenic
1027172870 7:75885274-75885296 CTCTATAAAATGAAGCAGCCAGG - Intronic
1027950093 7:84804300-84804322 CTGAGTGAAATGAGACAACAAGG + Intergenic
1029074913 7:97927935-97927957 CTGAACACATTTAGGCAGCACGG - Intergenic
1029118529 7:98251272-98251294 GTGAATAAACTGAGACAGAAAGG - Intronic
1029663947 7:101982259-101982281 GTGAGAAAAACGAGGCAGCAGGG - Intronic
1030370336 7:108693147-108693169 ATGAACTAAATGAGGCACCAGGG - Intergenic
1031107386 7:117561796-117561818 AGGAGTAAAATGAGGTAGCATGG + Intronic
1032179783 7:129664998-129665020 CTGAATAAAATAATGCGGGAAGG + Intronic
1032759197 7:134922827-134922849 TTAAATACACTGAGGCAGCAAGG + Intronic
1032939257 7:136769268-136769290 ATGAACTAAATGAGGCACCAGGG + Intergenic
1033308731 7:140243783-140243805 GTGAATTAAATGAGGATGCATGG + Intergenic
1034369118 7:150579202-150579224 ATGAATGAAATGAAGCAGGAAGG - Intergenic
1035084369 7:156245918-156245940 ATGAACTAAATGAGGCAACAGGG - Intergenic
1035112672 7:156496261-156496283 ATGAAAAAAATTAGGCAACAAGG - Intergenic
1038712475 8:29960637-29960659 CTGACAAAAATGATGCTGCATGG - Intergenic
1038871753 8:31503046-31503068 ATGAACTAAATAAGGCAGCAGGG - Intergenic
1039197322 8:35047181-35047203 CTGAATGAAATGTGGGGGCAGGG + Intergenic
1039272361 8:35897001-35897023 CTGAAGAAAATGAAGAAGCTTGG + Intergenic
1040091921 8:43407906-43407928 CTGGAAAAACTGAGGCAACAAGG - Intergenic
1040555068 8:48471143-48471165 CTAAATTAAATGAGGCAACAAGG + Intergenic
1041347313 8:56912955-56912977 CTGAAGAAAATGAAGCAGGCAGG - Intergenic
1041411487 8:57561130-57561152 CAGAATAAAATAAGACAGAATGG - Intergenic
1042988447 8:74610551-74610573 CTGAAAAAAAAGAGGCAACTTGG + Intronic
1044460492 8:92438859-92438881 CTGAGTAAAAGAAGACAGCAAGG - Intergenic
1044571985 8:93730232-93730254 CTGCAAAAACAGAGGCAGCAAGG + Exonic
1044685782 8:94823917-94823939 CTGAATAAATTCAGGGAGCTGGG + Intronic
1044814365 8:96096060-96096082 CTTCATAAAGTGAGGAAGCAGGG - Intergenic
1045319435 8:101070651-101070673 CTGAATAAAATGGGGAGGGAGGG - Intergenic
1045819255 8:106316565-106316587 CGAAATAAAATGAGGAAACAAGG - Intronic
1047079226 8:121442041-121442063 ATGAAGAAAATGAGGAAGAAAGG + Intergenic
1047640495 8:126814950-126814972 CTGAACAAAATGATGAAGCAAGG - Intergenic
1048577539 8:135705028-135705050 ATGAAGAAAATGAGGCCTCAAGG - Intergenic
1048702049 8:137102402-137102424 ACCAATAAAATCAGGCAGCAAGG + Intergenic
1048725884 8:137383472-137383494 ATGAATAAACTTAGGCATCAAGG - Intergenic
1050071014 9:1814158-1814180 CTGGATAATATGAGGGGGCAGGG + Intergenic
1050701378 9:8343515-8343537 CTAAATAAAATGAGACTTCATGG - Intronic
1050827013 9:9959586-9959608 CTGAAGAGAATGAGGTAGAAAGG + Intronic
1050889479 9:10806188-10806210 CTGAGTGAAAAGAGGCAGGAGGG - Intergenic
1052351352 9:27461500-27461522 AAGATTAAAATGAGGCAGCAAGG - Intronic
1053028165 9:34748849-34748871 ATGAATGAAATAAGGCACCAGGG + Intergenic
1054759713 9:68993366-68993388 CTGAAGGAAGTGAGGGAGCATGG - Intronic
1055862656 9:80771722-80771744 CTGTACAAAAGCAGGCAGCAGGG + Intergenic
1056054381 9:82805831-82805853 TGGAAAAAAATGGGGCAGCAAGG + Intergenic
1056062665 9:82900155-82900177 CTGAATAAACTGAGCCAGCAAGG - Intergenic
1056508189 9:87277335-87277357 CTGAATTAAATGAGGGAGGGCGG + Intergenic
1056993367 9:91431315-91431337 ATGAAGAAACTGAGGCATCAAGG - Intergenic
1057745394 9:97747103-97747125 CTTTATTAAAAGAGGCAGCAGGG - Intergenic
1058285070 9:103167954-103167976 ATGAACTAAATAAGGCAGCAGGG - Intergenic
1059300580 9:113309762-113309784 ATGTTTAAAATGAGGCTGCATGG - Intergenic
1059584141 9:115587861-115587883 CTGAATGAAATTTGGCAACAGGG - Intergenic
1060459457 9:123835944-123835966 CTCAATAAAATGAGGAAGAAGGG + Intronic
1060752137 9:126177788-126177810 CTGAAAAAAATAAGGTAGCTGGG + Intergenic
1186285187 X:8035761-8035783 CTGAATAAAAGAATGCTGCAGGG + Intergenic
1186299218 X:8180966-8180988 CTGAGAAAAATGCAGCAGCAGGG + Intergenic
1187253232 X:17618355-17618377 CTGAACAAAATAATGGAGCAAGG - Intronic
1187420722 X:19131353-19131375 GGGGAAAAAATGAGGCAGCAGGG - Intergenic
1187554374 X:20338089-20338111 CTGGAAAAAATGAGACAGGAGGG - Intergenic
1187925761 X:24248908-24248930 ATAAATGAAATGAGGCAGAATGG - Intergenic
1188293491 X:28417393-28417415 CTGAATGGACTGATGCAGCATGG - Intergenic
1188837959 X:34981775-34981797 CTGAATAGAATGAGGTAAAAGGG - Intergenic
1188854110 X:35171316-35171338 ATGAACAAAATAAGGCACCAGGG - Intergenic
1189013279 X:37069665-37069687 ATGAACTAAATAAGGCAGCAGGG - Intergenic
1189076283 X:37918715-37918737 CTGAGCACCATGAGGCAGCAGGG - Intronic
1189123575 X:38422206-38422228 CTGACTTAAATGAGTAAGCAAGG + Intronic
1189149540 X:38690977-38690999 CAAAATAACATCAGGCAGCAGGG - Intergenic
1189668617 X:43383933-43383955 CTGAGTCAAATCAAGCAGCAAGG - Intergenic
1190765576 X:53473172-53473194 CTGAAGAAAATGAAGCAGGGAGG + Intergenic
1192293397 X:69821713-69821735 GTTAATAAAATGTGGTAGCATGG + Intronic
1192850902 X:74954657-74954679 ATGAATAAAATGAAGCAAGAAGG + Intergenic
1193985630 X:88237631-88237653 CTGAAAAATATGAGGCAACTAGG - Intergenic
1194219498 X:91174348-91174370 ATGAACTAAATGAGGCACCAGGG - Intergenic
1194290941 X:92071455-92071477 ATGAACTAAATGAGGCACCAGGG - Intronic
1194546520 X:95240906-95240928 ATGAACAAAATAAGGCACCAGGG + Intergenic
1194957028 X:100192773-100192795 TTGAAAAAAATGAGGCAACTGGG - Intergenic
1195830562 X:109054054-109054076 ATGAAAAAAATGATACAGCATGG - Intergenic
1196616581 X:117773106-117773128 CTCTATGAAATGAGGAAGCAAGG + Intergenic
1197159448 X:123307305-123307327 CTGACTAAATTGGGGCAGAAGGG + Intronic
1197619737 X:128734145-128734167 CTGAATGAAATGAAGCAAGAAGG + Intergenic
1197876397 X:131113675-131113697 ATGAACTAAATGAGGCACCAGGG - Intergenic
1198293832 X:135264534-135264556 ATGAACTAAATAAGGCAGCAGGG + Intronic
1198675241 X:139124090-139124112 CTGAAGAAATTGAAGCAGCAGGG - Intronic
1198791526 X:140352154-140352176 CTGAATTAAATGAGAGAGCAAGG + Intergenic
1199316209 X:146380496-146380518 CCGAATGAAATAAGGCACCAGGG + Intergenic
1199982161 X:152927157-152927179 CTGATTTAAATGAGGCAGCCAGG + Intronic
1200391706 X:155952190-155952212 CTTAACAAAAAGATGCAGCAAGG + Intergenic
1200556011 Y:4638113-4638135 ATGAACTAAATGAGGCACCAGGG - Intergenic
1200608451 Y:5296030-5296052 ATGAACTAAATGAGGCACCAGGG - Intronic
1200772137 Y:7136007-7136029 ATGAATAAAATGAAGCAAGAAGG + Intergenic
1200914528 Y:8559806-8559828 CTGGATGAAGGGAGGCAGCAAGG + Intergenic
1201439963 Y:13997331-13997353 CTGAGAAAAATGCAGCAGCAGGG + Intergenic
1201444608 Y:14045377-14045399 CTGAGAAAAATGCAGCAGCAGGG - Intergenic
1201460950 Y:14223843-14223865 CTGCATAAAATCAGGCAGCAAGG + Intergenic
1201628208 Y:16038933-16038955 CGGAAGAAAAAGAGGGAGCAGGG + Intergenic