ID: 1011449072

View in Genome Browser
Species Human (GRCh38)
Location 6:87473398-87473420
Sequence GCAGAGGAGACCGGAGCCGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 268
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 248}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011449072_1011449082 12 Left 1011449072 6:87473398-87473420 CCCGCGGCTCCGGTCTCCTCTGC 0: 1
1: 0
2: 1
3: 18
4: 248
Right 1011449082 6:87473433-87473455 GTGGATGCTCAGAGGCTTAAAGG 0: 1
1: 0
2: 0
3: 9
4: 160
1011449072_1011449085 23 Left 1011449072 6:87473398-87473420 CCCGCGGCTCCGGTCTCCTCTGC 0: 1
1: 0
2: 1
3: 18
4: 248
Right 1011449085 6:87473444-87473466 GAGGCTTAAAGGCAGGCTCCGGG 0: 1
1: 0
2: 0
3: 19
4: 190
1011449072_1011449079 4 Left 1011449072 6:87473398-87473420 CCCGCGGCTCCGGTCTCCTCTGC 0: 1
1: 0
2: 1
3: 18
4: 248
Right 1011449079 6:87473425-87473447 CCTACCCTGTGGATGCTCAGAGG No data
1011449072_1011449084 22 Left 1011449072 6:87473398-87473420 CCCGCGGCTCCGGTCTCCTCTGC 0: 1
1: 0
2: 1
3: 18
4: 248
Right 1011449084 6:87473443-87473465 AGAGGCTTAAAGGCAGGCTCCGG No data
1011449072_1011449083 16 Left 1011449072 6:87473398-87473420 CCCGCGGCTCCGGTCTCCTCTGC 0: 1
1: 0
2: 1
3: 18
4: 248
Right 1011449083 6:87473437-87473459 ATGCTCAGAGGCTTAAAGGCAGG 0: 1
1: 0
2: 1
3: 13
4: 168
1011449072_1011449076 -7 Left 1011449072 6:87473398-87473420 CCCGCGGCTCCGGTCTCCTCTGC 0: 1
1: 0
2: 1
3: 18
4: 248
Right 1011449076 6:87473414-87473436 CCTCTGCGCCTCCTACCCTGTGG 0: 1
1: 0
2: 1
3: 29
4: 222

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011449072 Original CRISPR GCAGAGGAGACCGGAGCCGC GGG (reversed) Intronic