ID: 1011449076

View in Genome Browser
Species Human (GRCh38)
Location 6:87473414-87473436
Sequence CCTCTGCGCCTCCTACCCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 253
Summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 222}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011449069_1011449076 0 Left 1011449069 6:87473391-87473413 CCCTGGCCCCGCGGCTCCGGTCT No data
Right 1011449076 6:87473414-87473436 CCTCTGCGCCTCCTACCCTGTGG 0: 1
1: 0
2: 1
3: 29
4: 222
1011449071_1011449076 -6 Left 1011449071 6:87473397-87473419 CCCCGCGGCTCCGGTCTCCTCTG No data
Right 1011449076 6:87473414-87473436 CCTCTGCGCCTCCTACCCTGTGG 0: 1
1: 0
2: 1
3: 29
4: 222
1011449073_1011449076 -8 Left 1011449073 6:87473399-87473421 CCGCGGCTCCGGTCTCCTCTGCG 0: 1
1: 0
2: 0
3: 11
4: 175
Right 1011449076 6:87473414-87473436 CCTCTGCGCCTCCTACCCTGTGG 0: 1
1: 0
2: 1
3: 29
4: 222
1011449070_1011449076 -1 Left 1011449070 6:87473392-87473414 CCTGGCCCCGCGGCTCCGGTCTC 0: 1
1: 0
2: 3
3: 24
4: 292
Right 1011449076 6:87473414-87473436 CCTCTGCGCCTCCTACCCTGTGG 0: 1
1: 0
2: 1
3: 29
4: 222
1011449072_1011449076 -7 Left 1011449072 6:87473398-87473420 CCCGCGGCTCCGGTCTCCTCTGC 0: 1
1: 0
2: 1
3: 18
4: 248
Right 1011449076 6:87473414-87473436 CCTCTGCGCCTCCTACCCTGTGG 0: 1
1: 0
2: 1
3: 29
4: 222
1011449065_1011449076 24 Left 1011449065 6:87473367-87473389 CCAGCGAGGCAGGACAGTTCTTC 0: 1
1: 0
2: 0
3: 4
4: 103
Right 1011449076 6:87473414-87473436 CCTCTGCGCCTCCTACCCTGTGG 0: 1
1: 0
2: 1
3: 29
4: 222
1011449064_1011449076 25 Left 1011449064 6:87473366-87473388 CCCAGCGAGGCAGGACAGTTCTT No data
Right 1011449076 6:87473414-87473436 CCTCTGCGCCTCCTACCCTGTGG 0: 1
1: 0
2: 1
3: 29
4: 222

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011449076 Original CRISPR CCTCTGCGCCTCCTACCCTG TGG Intronic