ID: 1011449079

View in Genome Browser
Species Human (GRCh38)
Location 6:87473425-87473447
Sequence CCTACCCTGTGGATGCTCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011449073_1011449079 3 Left 1011449073 6:87473399-87473421 CCGCGGCTCCGGTCTCCTCTGCG 0: 1
1: 0
2: 0
3: 11
4: 175
Right 1011449079 6:87473425-87473447 CCTACCCTGTGGATGCTCAGAGG No data
1011449071_1011449079 5 Left 1011449071 6:87473397-87473419 CCCCGCGGCTCCGGTCTCCTCTG No data
Right 1011449079 6:87473425-87473447 CCTACCCTGTGGATGCTCAGAGG No data
1011449069_1011449079 11 Left 1011449069 6:87473391-87473413 CCCTGGCCCCGCGGCTCCGGTCT No data
Right 1011449079 6:87473425-87473447 CCTACCCTGTGGATGCTCAGAGG No data
1011449072_1011449079 4 Left 1011449072 6:87473398-87473420 CCCGCGGCTCCGGTCTCCTCTGC 0: 1
1: 0
2: 1
3: 18
4: 248
Right 1011449079 6:87473425-87473447 CCTACCCTGTGGATGCTCAGAGG No data
1011449074_1011449079 -5 Left 1011449074 6:87473407-87473429 CCGGTCTCCTCTGCGCCTCCTAC No data
Right 1011449079 6:87473425-87473447 CCTACCCTGTGGATGCTCAGAGG No data
1011449070_1011449079 10 Left 1011449070 6:87473392-87473414 CCTGGCCCCGCGGCTCCGGTCTC 0: 1
1: 0
2: 3
3: 24
4: 292
Right 1011449079 6:87473425-87473447 CCTACCCTGTGGATGCTCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011449079 Original CRISPR CCTACCCTGTGGATGCTCAG AGG Intronic