ID: 1011449082

View in Genome Browser
Species Human (GRCh38)
Location 6:87473433-87473455
Sequence GTGGATGCTCAGAGGCTTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 160}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011449070_1011449082 18 Left 1011449070 6:87473392-87473414 CCTGGCCCCGCGGCTCCGGTCTC 0: 1
1: 0
2: 3
3: 24
4: 292
Right 1011449082 6:87473433-87473455 GTGGATGCTCAGAGGCTTAAAGG 0: 1
1: 0
2: 0
3: 9
4: 160
1011449073_1011449082 11 Left 1011449073 6:87473399-87473421 CCGCGGCTCCGGTCTCCTCTGCG 0: 1
1: 0
2: 0
3: 11
4: 175
Right 1011449082 6:87473433-87473455 GTGGATGCTCAGAGGCTTAAAGG 0: 1
1: 0
2: 0
3: 9
4: 160
1011449072_1011449082 12 Left 1011449072 6:87473398-87473420 CCCGCGGCTCCGGTCTCCTCTGC 0: 1
1: 0
2: 1
3: 18
4: 248
Right 1011449082 6:87473433-87473455 GTGGATGCTCAGAGGCTTAAAGG 0: 1
1: 0
2: 0
3: 9
4: 160
1011449074_1011449082 3 Left 1011449074 6:87473407-87473429 CCGGTCTCCTCTGCGCCTCCTAC 0: 1
1: 0
2: 1
3: 31
4: 312
Right 1011449082 6:87473433-87473455 GTGGATGCTCAGAGGCTTAAAGG 0: 1
1: 0
2: 0
3: 9
4: 160
1011449075_1011449082 -4 Left 1011449075 6:87473414-87473436 CCTCTGCGCCTCCTACCCTGTGG 0: 1
1: 0
2: 2
3: 30
4: 248
Right 1011449082 6:87473433-87473455 GTGGATGCTCAGAGGCTTAAAGG 0: 1
1: 0
2: 0
3: 9
4: 160
1011449069_1011449082 19 Left 1011449069 6:87473391-87473413 CCCTGGCCCCGCGGCTCCGGTCT 0: 1
1: 0
2: 0
3: 7
4: 110
Right 1011449082 6:87473433-87473455 GTGGATGCTCAGAGGCTTAAAGG 0: 1
1: 0
2: 0
3: 9
4: 160
1011449071_1011449082 13 Left 1011449071 6:87473397-87473419 CCCCGCGGCTCCGGTCTCCTCTG 0: 1
1: 0
2: 0
3: 17
4: 128
Right 1011449082 6:87473433-87473455 GTGGATGCTCAGAGGCTTAAAGG 0: 1
1: 0
2: 0
3: 9
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011449082 Original CRISPR GTGGATGCTCAGAGGCTTAA AGG Intronic
900705880 1:4079905-4079927 CTGGATGCCCAGAGTCTTCAGGG + Intergenic
903237841 1:21961916-21961938 TTGGAGGCTCAGAGGCTCAGAGG + Intergenic
907405212 1:54249876-54249898 ATGGATCCTCAGAGGCTCAGCGG - Intronic
911130704 1:94384838-94384860 GTGGCGGCTCAGAGGCTGCAGGG + Intergenic
912350130 1:109004683-109004705 GTTGATGCACAGAGGCCTATCGG - Exonic
912978207 1:114348553-114348575 GAGGAGGCTCAGAGCCTGAAGGG + Intergenic
919652778 1:200166788-200166810 GTGGAAAAACAGAGGCTTAAAGG - Intronic
921188326 1:212688482-212688504 ATGGATGCTATGGGGCTTAAGGG + Intronic
1063251445 10:4279474-4279496 GTGAACGCTCAGAGGGTTAAGGG - Intergenic
1065818950 10:29507326-29507348 ATCGAAGCTCAGAGGCTGAAAGG + Intronic
1066033347 10:31453112-31453134 GTGCATGCTTAGGGGCTTGATGG + Intronic
1069064916 10:63932314-63932336 TTGAATGCTCTGAGGATTAAGGG - Intergenic
1069716990 10:70527509-70527531 GTGGATGCTTAGGGCCTCAATGG + Intronic
1070522164 10:77263518-77263540 GTAGCTCCTCAGTGGCTTAATGG + Intronic
1071548222 10:86544931-86544953 GTGGATGCTCTGAGGCTCTGAGG - Intergenic
1072725957 10:97814168-97814190 GAGGATGCTCTGTGGCTTTATGG + Intergenic
1073320616 10:102614098-102614120 GTGCATCCTCAGAGCCTTCAGGG + Intronic
1074721060 10:116265701-116265723 GTGGGCGCTCAGAGGCTCAGAGG - Intronic
1075098447 10:119489343-119489365 CTGTGTGCACAGAGGCTTAAAGG - Intergenic
1075341541 10:121650226-121650248 ATGCATGCTAAGAGGCTTTAGGG - Intergenic
1076081873 10:127589584-127589606 GTGACTGCTCAGAGCCTTAAAGG - Intergenic
1077831795 11:5880608-5880630 CTTGTTGCTCAGAGGCTTCAAGG + Intronic
1081411536 11:42764254-42764276 GTGGATGATCACTGACTTAATGG + Intergenic
1085363289 11:75912484-75912506 TCTAATGCTCAGAGGCTTAAAGG + Intronic
1085727929 11:78970727-78970749 GAGGTTGCTCTGAGGGTTAAAGG + Intronic
1085741498 11:79081559-79081581 GTGCATGCACACATGCTTAATGG + Intronic
1086609951 11:88743583-88743605 GTGGACTCTCACAGGCTGAATGG + Intronic
1086630611 11:89014545-89014567 GTGGAGGCACAGATGATTAATGG + Intronic
1088595503 11:111437601-111437623 GAGGATGCTCAGAGGCTCTCCGG - Intronic
1089115182 11:116089202-116089224 GAGGATGCTCAGAGGAGGAAAGG - Intergenic
1089471130 11:118720998-118721020 GTGGAGGAGCAGAGGCTTGAAGG + Intergenic
1090314108 11:125769890-125769912 ATGGATGCTCAGAGGCAAAATGG + Intergenic
1090720186 11:129465497-129465519 GTGGATGAAAAGAGACTTAAGGG - Intergenic
1092219640 12:6704000-6704022 CAGGATGCTCTGGGGCTTAAGGG - Intergenic
1096513888 12:52146008-52146030 GTGGATGCTGGGGGGCTTAGCGG + Intergenic
1099621703 12:85009581-85009603 TTGGATGCTCAGAAGATGAAAGG + Intergenic
1103834083 12:123805144-123805166 TTGGATGGTCAGAGGCTTTCTGG + Intronic
1108226098 13:48291122-48291144 GTGGATGCTCTGGGGATTGAGGG - Intergenic
1113284109 13:108827823-108827845 GTCCATGCTCAGACGCTAAAGGG - Intronic
1113600412 13:111564407-111564429 GTGGATGCTAAATGACTTAATGG - Intergenic
1113616966 13:111687025-111687047 GTGGATGTTGAGTGGCTTTATGG + Intergenic
1113622496 13:111772296-111772318 GTGGATGTTGAGTGGCTTTATGG + Intergenic
1117148980 14:52866182-52866204 GTGTAGGCTCAGAGGCCTACAGG + Intronic
1119979401 14:79062389-79062411 GTGAATGTTCACAGTCTTAAGGG - Intronic
1119986877 14:79148219-79148241 CTGGAAGCTCAGAGGGTTCATGG + Intronic
1120384747 14:83830264-83830286 GTGGATTCTCTGATGTTTAATGG + Intergenic
1121636397 14:95456673-95456695 TTGGGTCCTCAGAGGCTTTATGG - Intronic
1123828683 15:24109759-24109781 GTGGATACTCTGAGTCTAAAGGG - Intergenic
1124785374 15:32674047-32674069 GTGTATTCTCAGAGTATTAAAGG - Intronic
1125436831 15:39654885-39654907 TTGTCTGCCCAGAGGCTTAAAGG + Intronic
1126439636 15:48673581-48673603 GTCGTTGCTCTGAGGCTTAGTGG - Intergenic
1126811893 15:52414965-52414987 GGGGAAGTTCAGAGGCTTCATGG - Intronic
1130829820 15:87587765-87587787 ATGGATGCTATGAGGTTTAAAGG + Intergenic
1131994216 15:98118932-98118954 CTGGATCCTCAGATGCTTAGAGG - Intergenic
1135899766 16:26446274-26446296 TTGGATTCTCAGAGGCTCAGTGG - Intergenic
1139666492 16:68460541-68460563 ATGGATGCCCAGAGGGTTACAGG + Intergenic
1144754614 17:17671573-17671595 GGGGCTGCTCAGAGGAGTAAGGG + Intergenic
1145262466 17:21362816-21362838 GTGGATGAACAGAGGATGAATGG + Intergenic
1146607183 17:34270806-34270828 TTGAATGCTCAGAGCCTAAAAGG + Intronic
1146692926 17:34889162-34889184 ACTGAGGCTCAGAGGCTTAAAGG + Intergenic
1147306637 17:39568751-39568773 GTGGGGGCTCAGAGGCATGAAGG - Intergenic
1149786163 17:59437143-59437165 GTGTATGCTCATCGGCTTCAGGG - Intergenic
1150243183 17:63652366-63652388 ATAGATGCTCAGAGGGTGAAAGG + Intronic
1155535124 18:26809075-26809097 ATGTATGCACAGAGGCTGAAGGG + Intergenic
1155577399 18:27263211-27263233 ATGGATGTTTAGAGGCTTTATGG + Intergenic
1155869619 18:31009605-31009627 GTGGATACACAGAGGAGTAAGGG + Intronic
1157842671 18:50973809-50973831 GTATATGTTCAGAAGCTTAAGGG + Intronic
1160128665 18:76204521-76204543 GGGGAAGCTCACAGGATTAAAGG - Intergenic
1160553495 18:79711382-79711404 CTGGATACTCAGAGGCAAAAGGG - Intronic
1160812304 19:1018085-1018107 GTGGATGCCCACAGGGTGAAGGG - Intronic
1164241475 19:23393302-23393324 GTGGATGCCCTGAGGCTGAGAGG - Intronic
1164316157 19:24089666-24089688 GTGGATGCCCTGAGTCTAAAAGG + Intronic
1167101389 19:47406327-47406349 GTGGGTTCTCTGAGGCTTGATGG - Intronic
1167303999 19:48696489-48696511 GGGGCTCCTCAGAGGCTTCATGG + Intronic
1168482986 19:56737076-56737098 TTGGATGCTCAGAGGCAGGATGG + Intergenic
927576888 2:24207870-24207892 GTGGCTGCTCAGGAGCTGAAGGG + Intronic
927878628 2:26675137-26675159 GTGAATCTTCAGAGGCTTCAGGG + Intergenic
928342177 2:30453865-30453887 GTGGAAGCTGGGAGGGTTAAAGG - Intronic
931472009 2:62547895-62547917 GTGGATGCTCAGGTGTGTAATGG - Intergenic
934524634 2:95043977-95043999 GTGGTTCCTCAGAGGCTTCTGGG + Intronic
941583813 2:167331932-167331954 GCGCATGCTCAGAGGCCTCAAGG - Intergenic
944450693 2:199839089-199839111 GTGGATGCTGGAAGGCTGAATGG - Intronic
946763433 2:223018432-223018454 GTGGTTGCTCAGAGCTTCAAAGG - Intergenic
1172436636 20:34933415-34933437 GTGGATGATCACAGGATGAATGG + Intronic
1175549322 20:59806381-59806403 GTGCATGCTCAGATGTTTAGCGG + Intronic
1178713414 21:34941208-34941230 CTGGAGGCACAGAGGCTAAAGGG - Intronic
1178756388 21:35354138-35354160 GTGGATGCCCAGGGGCTGAGGGG - Intronic
1181778610 22:25177500-25177522 GTGGATGTTCAAAGACTCAACGG + Exonic
1184019950 22:41814154-41814176 GTTGGTGCTCAGAGGTTCAAAGG - Intronic
1184047688 22:41981717-41981739 GTTGATGCTCATGGGCTTCATGG - Exonic
1184646341 22:45897388-45897410 GGGGGTGCTCAGAGGCTGATGGG + Intergenic
1185335619 22:50269826-50269848 GTGGGTGCTCAGACGTTTAGGGG + Intronic
1185376397 22:50484446-50484468 GTGGCTGCTGAGAGGCTGCAGGG + Exonic
950191628 3:10980681-10980703 GTGGATGCCATGAGCCTTAATGG + Intergenic
952872258 3:37911455-37911477 GTGGGAGCTCAGAGCCTTGAGGG + Intronic
957716463 3:83935130-83935152 GTGGATGCTCAAGGGCTTTGTGG + Intergenic
957797226 3:85026008-85026030 GTGGGTGCTCAAGGGCTTTATGG + Intronic
959874399 3:111364741-111364763 GTAGATCCTGAGAGGATTAATGG + Intronic
960288932 3:115860967-115860989 GTGGGTGCTGGCAGGCTTAAAGG - Intronic
962695163 3:137940638-137940660 GTAGATGCACACAGGCTAAAAGG - Intergenic
967314503 3:188138492-188138514 CTGGATGCTTGGATGCTTAAAGG + Intergenic
967429778 3:189368721-189368743 GTAGATACTCAGATGCTTACTGG + Intergenic
967914330 3:194567105-194567127 CTGGATGGTCAGAGACTTAAAGG - Intergenic
969499604 4:7544720-7544742 GTGGGTGCTCAGAGCCTGCAAGG - Intronic
970676349 4:18454705-18454727 GAGACTGCTCAGAGGCTTAAGGG - Intergenic
971328152 4:25661241-25661263 CTTTATGCTCAGAGGCATAAAGG + Intronic
971427866 4:26533675-26533697 GTGGATGGTCAGATGCCTACAGG + Intergenic
973538354 4:51907791-51907813 CTGGATACTCAGATGTTTAAAGG + Intronic
977664437 4:99629356-99629378 GTAGAAGCTGAGAGGCTTGAAGG - Intergenic
978623875 4:110662503-110662525 GCTGATGCTTAGAGGCTCAAAGG + Intergenic
983987486 4:174077757-174077779 GTAGATTCTCAGAGACTCAAGGG + Intergenic
984057139 4:174943554-174943576 GTGGATTCTCAGAGACCTGATGG - Intronic
985525047 5:397410-397432 GTGGATGGTCAGGGGCTAACAGG - Intronic
985525088 5:397581-397603 GTGGATGGTCAGGGGCTAACAGG - Intronic
985525111 5:397677-397699 GTGGATGGTCAGGGGCTACATGG - Intronic
985525155 5:397867-397889 GTGGATGGTCAGGGGCTAACAGG - Intronic
986861186 5:11928231-11928253 GTGGATGGTCAGAGAGTTGATGG - Intergenic
987461263 5:18213978-18214000 GTGGATGCTCAGAATGATAAAGG - Intergenic
989260250 5:39411535-39411557 GTGGATCCTCCAAGGCTTCAAGG - Intronic
989365049 5:40646405-40646427 GTGGATAATCAGAGGCCAAAGGG + Intergenic
991573263 5:68077442-68077464 GTGGATTCTCAAAGGCTGAATGG + Intergenic
992002630 5:72450703-72450725 GTGGAAGGTCAGAGGCTGAGAGG - Intronic
992665130 5:79000885-79000907 TTGAATGCTCATTGGCTTAAAGG - Intronic
993085852 5:83363096-83363118 CAGGATGCTCAGAGGCACAAAGG + Intergenic
994271833 5:97786749-97786771 GAGGATGCTAAGAGGGATAAAGG + Intergenic
996223583 5:120962245-120962267 GTGGATGGTTAAAGTCTTAAAGG - Intergenic
998441494 5:142166328-142166350 GTGGATGCTCAGAGCACAAAAGG + Intergenic
999577172 5:152991913-152991935 GTGGTACCTCAAAGGCTTAAGGG - Intergenic
1002436244 5:179233768-179233790 ATGGCTGCTCAGCGGCTTGAGGG - Intronic
1002633052 5:180593725-180593747 GTGGCTGCTCAGAGGTAGAATGG + Intergenic
1008547768 6:52598435-52598457 GTGGATGATCAAAGGATAAAGGG + Intergenic
1010173157 6:72996266-72996288 TTGGATGCCAAGAGGCTCAAAGG - Intronic
1011442869 6:87405979-87406001 GTGGATGCTAAGAGGCATGAAGG + Intergenic
1011449082 6:87473433-87473455 GTGGATGCTCAGAGGCTTAAAGG + Intronic
1011792197 6:90910668-90910690 CTGGATGCTGTGGGGCTTAAGGG + Intergenic
1016712640 6:147191242-147191264 GTGGATGCTTAGATTATTAAAGG + Intergenic
1016868609 6:148794887-148794909 GTGAATGCTCAGAGACGAAAAGG - Intronic
1016917286 6:149256046-149256068 CTGGTTGATCAGAGGCTTGAAGG - Intronic
1017441150 6:154465451-154465473 GGGGATGCTAGGAGACTTAAGGG - Intronic
1017504245 6:155053106-155053128 TTGGATGCTCAAAGTCATAATGG - Intronic
1018072746 6:160179827-160179849 GTTGATGCTCAGAGTCTAAATGG + Intronic
1018415352 6:163596877-163596899 GGGTATTCCCAGAGGCTTAATGG + Intergenic
1021437308 7:20634025-20634047 TTGGAGACTCAGAGGCTGAAAGG - Intronic
1024550882 7:50561577-50561599 TTAGATGCTGATAGGCTTAAGGG - Intronic
1024571690 7:50728515-50728537 TTGGATGGACAGAGGCTCAAGGG - Intronic
1025825164 7:65005087-65005109 GTGGATGCCCTGAGGCTGAGAGG - Intronic
1026402783 7:70032606-70032628 GTGTATACACAGTGGCTTAAAGG - Intronic
1028308965 7:89305051-89305073 GTGGAGGCACAGACACTTAAAGG - Intronic
1030537681 7:110789681-110789703 GTGGAGGCTCAGAGGATGAAGGG - Intronic
1030825187 7:114147469-114147491 ATGGTTGCTCAGAGGATCAAGGG - Intronic
1033362170 7:140645402-140645424 GCCGATGCTCACAGGCTTCATGG + Intronic
1035708574 8:1695728-1695750 GAGGCTGCTCAGAGGCTGTAGGG - Intronic
1043346863 8:79308346-79308368 GTGGATGCTCAGGAGCTGACAGG + Intergenic
1044958517 8:97506310-97506332 GGGGATGCACAGAGCCTTACAGG + Intergenic
1046450393 8:114383090-114383112 GAAGATGCCCAGAGGCTTATGGG + Intergenic
1048560219 8:135528093-135528115 GAGAATGCTTAGAGGCTAAAAGG - Intronic
1051958902 9:22734333-22734355 CTGGAAGCTCATAGGCTTCACGG - Intergenic
1054748343 9:68878886-68878908 ATGGATGCTCAGGGGGTGAAGGG + Intronic
1055067288 9:72131576-72131598 GTGCAGGCTCAGAGGGTTCAGGG - Intronic
1055483966 9:76738733-76738755 GTGTATGCTCAGAGACATCATGG + Intronic
1057368201 9:94444177-94444199 CTGGATGGTCAGATGCTTATCGG - Intronic
1057749903 9:97783977-97783999 GAGGATGGTCAGAGGCATAGCGG + Intergenic
1060740369 9:126093874-126093896 GTGGATCCTCAGAGGGCCAAGGG - Intergenic
1062016240 9:134292690-134292712 GGGGATGCCCAGAGGGTTGAGGG + Intergenic
1192626362 X:72732866-72732888 GTGGATTCTCATAGCCTTTAGGG + Intergenic
1192819651 X:74631134-74631156 GTAGATGCTCAGATGCTCAGTGG - Intergenic
1197013439 X:121594417-121594439 GTGTATGATCAGAGACTTACAGG - Intergenic
1197988914 X:132296152-132296174 CTGGATGGTCAGAGACTTGAAGG - Intergenic
1198911495 X:141620038-141620060 GGGGATGCAGAGAGGCTGAAGGG - Intronic
1198966572 X:142233458-142233480 GTGGCTGCTCAGAGGTCTATTGG - Intergenic