ID: 1011449083

View in Genome Browser
Species Human (GRCh38)
Location 6:87473437-87473459
Sequence ATGCTCAGAGGCTTAAAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 168}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011449071_1011449083 17 Left 1011449071 6:87473397-87473419 CCCCGCGGCTCCGGTCTCCTCTG No data
Right 1011449083 6:87473437-87473459 ATGCTCAGAGGCTTAAAGGCAGG 0: 1
1: 0
2: 1
3: 13
4: 168
1011449069_1011449083 23 Left 1011449069 6:87473391-87473413 CCCTGGCCCCGCGGCTCCGGTCT No data
Right 1011449083 6:87473437-87473459 ATGCTCAGAGGCTTAAAGGCAGG 0: 1
1: 0
2: 1
3: 13
4: 168
1011449070_1011449083 22 Left 1011449070 6:87473392-87473414 CCTGGCCCCGCGGCTCCGGTCTC 0: 1
1: 0
2: 3
3: 24
4: 292
Right 1011449083 6:87473437-87473459 ATGCTCAGAGGCTTAAAGGCAGG 0: 1
1: 0
2: 1
3: 13
4: 168
1011449077_1011449083 -8 Left 1011449077 6:87473422-87473444 CCTCCTACCCTGTGGATGCTCAG 0: 1
1: 0
2: 1
3: 17
4: 230
Right 1011449083 6:87473437-87473459 ATGCTCAGAGGCTTAAAGGCAGG 0: 1
1: 0
2: 1
3: 13
4: 168
1011449075_1011449083 0 Left 1011449075 6:87473414-87473436 CCTCTGCGCCTCCTACCCTGTGG 0: 1
1: 0
2: 2
3: 30
4: 248
Right 1011449083 6:87473437-87473459 ATGCTCAGAGGCTTAAAGGCAGG 0: 1
1: 0
2: 1
3: 13
4: 168
1011449074_1011449083 7 Left 1011449074 6:87473407-87473429 CCGGTCTCCTCTGCGCCTCCTAC No data
Right 1011449083 6:87473437-87473459 ATGCTCAGAGGCTTAAAGGCAGG 0: 1
1: 0
2: 1
3: 13
4: 168
1011449073_1011449083 15 Left 1011449073 6:87473399-87473421 CCGCGGCTCCGGTCTCCTCTGCG 0: 1
1: 0
2: 0
3: 11
4: 175
Right 1011449083 6:87473437-87473459 ATGCTCAGAGGCTTAAAGGCAGG 0: 1
1: 0
2: 1
3: 13
4: 168
1011449072_1011449083 16 Left 1011449072 6:87473398-87473420 CCCGCGGCTCCGGTCTCCTCTGC 0: 1
1: 0
2: 1
3: 18
4: 248
Right 1011449083 6:87473437-87473459 ATGCTCAGAGGCTTAAAGGCAGG 0: 1
1: 0
2: 1
3: 13
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011449083 Original CRISPR ATGCTCAGAGGCTTAAAGGC AGG Intronic