ID: 1011449085

View in Genome Browser
Species Human (GRCh38)
Location 6:87473444-87473466
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 210
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 190}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011449080_1011449085 -8 Left 1011449080 6:87473429-87473451 CCCTGTGGATGCTCAGAGGCTTA 0: 1
1: 0
2: 0
3: 10
4: 151
Right 1011449085 6:87473444-87473466 GAGGCTTAAAGGCAGGCTCCGGG 0: 1
1: 0
2: 0
3: 19
4: 190
1011449072_1011449085 23 Left 1011449072 6:87473398-87473420 CCCGCGGCTCCGGTCTCCTCTGC 0: 1
1: 0
2: 1
3: 18
4: 248
Right 1011449085 6:87473444-87473466 GAGGCTTAAAGGCAGGCTCCGGG 0: 1
1: 0
2: 0
3: 19
4: 190
1011449074_1011449085 14 Left 1011449074 6:87473407-87473429 CCGGTCTCCTCTGCGCCTCCTAC No data
Right 1011449085 6:87473444-87473466 GAGGCTTAAAGGCAGGCTCCGGG 0: 1
1: 0
2: 0
3: 19
4: 190
1011449081_1011449085 -9 Left 1011449081 6:87473430-87473452 CCTGTGGATGCTCAGAGGCTTAA 0: 1
1: 0
2: 1
3: 10
4: 121
Right 1011449085 6:87473444-87473466 GAGGCTTAAAGGCAGGCTCCGGG 0: 1
1: 0
2: 0
3: 19
4: 190
1011449078_1011449085 -4 Left 1011449078 6:87473425-87473447 CCTACCCTGTGGATGCTCAGAGG No data
Right 1011449085 6:87473444-87473466 GAGGCTTAAAGGCAGGCTCCGGG 0: 1
1: 0
2: 0
3: 19
4: 190
1011449075_1011449085 7 Left 1011449075 6:87473414-87473436 CCTCTGCGCCTCCTACCCTGTGG 0: 1
1: 0
2: 2
3: 30
4: 248
Right 1011449085 6:87473444-87473466 GAGGCTTAAAGGCAGGCTCCGGG 0: 1
1: 0
2: 0
3: 19
4: 190
1011449077_1011449085 -1 Left 1011449077 6:87473422-87473444 CCTCCTACCCTGTGGATGCTCAG 0: 1
1: 0
2: 1
3: 17
4: 230
Right 1011449085 6:87473444-87473466 GAGGCTTAAAGGCAGGCTCCGGG 0: 1
1: 0
2: 0
3: 19
4: 190
1011449069_1011449085 30 Left 1011449069 6:87473391-87473413 CCCTGGCCCCGCGGCTCCGGTCT No data
Right 1011449085 6:87473444-87473466 GAGGCTTAAAGGCAGGCTCCGGG 0: 1
1: 0
2: 0
3: 19
4: 190
1011449073_1011449085 22 Left 1011449073 6:87473399-87473421 CCGCGGCTCCGGTCTCCTCTGCG 0: 1
1: 0
2: 0
3: 11
4: 175
Right 1011449085 6:87473444-87473466 GAGGCTTAAAGGCAGGCTCCGGG 0: 1
1: 0
2: 0
3: 19
4: 190
1011449070_1011449085 29 Left 1011449070 6:87473392-87473414 CCTGGCCCCGCGGCTCCGGTCTC 0: 1
1: 0
2: 3
3: 24
4: 292
Right 1011449085 6:87473444-87473466 GAGGCTTAAAGGCAGGCTCCGGG 0: 1
1: 0
2: 0
3: 19
4: 190
1011449071_1011449085 24 Left 1011449071 6:87473397-87473419 CCCCGCGGCTCCGGTCTCCTCTG No data
Right 1011449085 6:87473444-87473466 GAGGCTTAAAGGCAGGCTCCGGG 0: 1
1: 0
2: 0
3: 19
4: 190

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type