ID: 1011453716

View in Genome Browser
Species Human (GRCh38)
Location 6:87524278-87524300
Sequence TACCAAATCCCAATGAGTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 92}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011453713_1011453716 -9 Left 1011453713 6:87524264-87524286 CCCTCAGCCTGCTTTACCAAATC 0: 1
1: 0
2: 1
3: 13
4: 150
Right 1011453716 6:87524278-87524300 TACCAAATCCCAATGAGTTCTGG 0: 1
1: 0
2: 0
3: 10
4: 92
1011453714_1011453716 -10 Left 1011453714 6:87524265-87524287 CCTCAGCCTGCTTTACCAAATCC 0: 1
1: 0
2: 0
3: 16
4: 164
Right 1011453716 6:87524278-87524300 TACCAAATCCCAATGAGTTCTGG 0: 1
1: 0
2: 0
3: 10
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011453716 Original CRISPR TACCAAATCCCAATGAGTTC TGG Intronic
907378366 1:54063704-54063726 TCCCAAATCCCAAACATTTCTGG + Intronic
908864139 1:68527078-68527100 GACCAAATCCCAAGAAGTTAAGG + Intergenic
909735400 1:78953665-78953687 AACCAAATACCAATGAATTCAGG + Intronic
917739468 1:177948387-177948409 TACCAAATGCCTATGTTTTCTGG + Intronic
919579730 1:199356568-199356590 TACCAAATAATAATGATTTCAGG - Intergenic
921261809 1:213391060-213391082 CCCCAAATCCCAGTGAATTCAGG - Intergenic
921315724 1:213888398-213888420 TTCCACAACCCAATGAGTTGTGG + Intergenic
921364860 1:214364211-214364233 TACAAAATGCCAAAGACTTCTGG + Intronic
921500816 1:215900779-215900801 TACCAACTCCAGATGAGGTCTGG - Exonic
1067592665 10:47526499-47526521 TCCCAACTCTCAATGAGTTTAGG + Intronic
1067606345 10:47666831-47666853 TTCCAAATACCTATGAGTTGAGG - Intergenic
1071621906 10:87128184-87128206 TTCCAAATACCTATGAGTTGAGG - Intronic
1071901580 10:90126104-90126126 TAGCAAAACACAATGAGGTCAGG - Intergenic
1072697514 10:97614864-97614886 TACCAAAACCCCAGGGGTTCGGG + Exonic
1078404712 11:11060334-11060356 GCCCAAATCCCAAGGAGTCCTGG - Intergenic
1080935820 11:36862316-36862338 TGCCACATTTCAATGAGTTCTGG - Intergenic
1082783838 11:57305764-57305786 TAACAAAACCCCATGAGTACTGG + Intronic
1088594264 11:111428166-111428188 TACCAAATCCCAGATATTTCAGG - Intronic
1089623394 11:119735808-119735830 TCCCAAATCCTAAAGAATTCTGG + Intergenic
1089809020 11:121116188-121116210 TCTCAAATCCTAATGAGCTCTGG - Intronic
1094662473 12:32483622-32483644 GACCATATGCCAATGAGTTATGG - Intronic
1097046810 12:56193071-56193093 TACCAAATCCCAATTTGCACAGG + Intergenic
1097382289 12:58909295-58909317 TACCAAATCCTACTATGTTCTGG - Intronic
1098815093 12:75149994-75150016 TGCAAAATACCAAAGAGTTCTGG - Intronic
1100044485 12:90362241-90362263 TAACAACTACCAATGAGTTTTGG + Intergenic
1100213795 12:92426793-92426815 CATCAAATCCCAATGATTTCTGG - Intronic
1101363052 12:104045625-104045647 TACCAGATGCCAAAGAGTTTAGG + Intronic
1101497677 12:105270871-105270893 GACCAAATTCCAGTGAGTACTGG + Intronic
1104519686 12:129461867-129461889 TACCAAATACGGATAAGTTCAGG + Intronic
1106483413 13:30153829-30153851 TACAGAACCCCAGTGAGTTCTGG + Intergenic
1109060204 13:57607956-57607978 TAAGAAATGCCAATTAGTTCAGG + Intergenic
1110756173 13:79177034-79177056 TACCAGAACCCAATGAGAACTGG + Intergenic
1112767551 13:102762071-102762093 TACCAAATCCAAATGAGTAGGGG - Intergenic
1114696768 14:24633131-24633153 TCCCAAATGCCCAGGAGTTCTGG - Intronic
1114830973 14:26141061-26141083 GACCACATCCAAATCAGTTCAGG + Intergenic
1117830399 14:59744259-59744281 TACCATATCCCAAAGAGCTTTGG - Intronic
1117832425 14:59765686-59765708 AACCAAAACCAAATGTGTTCTGG + Intronic
1121928431 14:97949654-97949676 TGCCACATCCCAAGGGGTTCAGG + Intronic
1125245310 15:37629935-37629957 TACCAAATCCCAAGGTGCTAGGG + Intergenic
1137411643 16:48233332-48233354 TACCAAATCACAACCAGATCTGG + Intronic
1144448195 17:15351669-15351691 AACCAAAGACTAATGAGTTCTGG + Intergenic
1155904158 18:31429199-31429221 CACAAAATCCCAAAGAATTCTGG - Intergenic
1162258012 19:9508653-9508675 GACCAAATTCCAGTGAGGTCTGG - Intergenic
930475267 2:51874104-51874126 TTCCAAAGCCCAATGTGTACAGG + Intergenic
932070015 2:68610764-68610786 TTCCAGATCCCACTGAGTTTTGG - Intronic
938597205 2:132800328-132800350 CTGCAAATCCCAATGAATTCTGG + Intronic
942227269 2:173828419-173828441 AACCAAATGCCAAGGAGTTCAGG + Intergenic
944496422 2:200311668-200311690 TACCACATCCCATTGTATTCAGG + Intronic
947323047 2:228944133-228944155 GACAAAATCCCAATGAATTCAGG + Intronic
948636350 2:239340288-239340310 TACCAAATCCTACTGAGGACTGG + Intronic
1177272524 21:18868100-18868122 TATCAAATCCATTTGAGTTCAGG + Intergenic
1178078755 21:29039377-29039399 TCCCAAATCTCAGAGAGTTCTGG - Intronic
1179033690 21:37741871-37741893 TTCCACAACCCAAAGAGTTCTGG - Intronic
1181723455 22:24794202-24794224 TACAAATTCCCTATGTGTTCTGG - Intergenic
1183626333 22:39004773-39004795 TATCGATTTCCAATGAGTTCAGG + Intergenic
951464465 3:22987253-22987275 TACCAAATTCCAGTGAATACAGG - Intergenic
957120794 3:76089214-76089236 TACCAGACCCAGATGAGTTCAGG + Intronic
958749706 3:98180338-98180360 TACCAATTTCCAATGAGAGCAGG + Intronic
959996070 3:112681919-112681941 TACAAAATTCCAGTGAGTGCTGG + Intergenic
964928865 3:161991067-161991089 TACAAAATCCAAGTGAGCTCAGG + Intergenic
969086167 4:4658091-4658113 TAACAAAACCTAATGAATTCAGG + Intergenic
970128072 4:12836660-12836682 AACCAAATACCAATGACTTCTGG + Intergenic
975783151 4:77860605-77860627 TACCTAATGCCATCGAGTTCTGG + Intergenic
977633114 4:99264531-99264553 TACAAAATCCCAATTACTTCAGG - Intergenic
978249024 4:106608844-106608866 TACCAGTGCCCAATGAGTTGGGG + Intergenic
980436710 4:132785122-132785144 TACCAAATGCAAATGAATACAGG + Intergenic
983220851 4:165043225-165043247 TACCAAATCCCCTGGAGTTGAGG - Intergenic
984516517 4:180747952-180747974 TACGAAATCCCAATGATTTGGGG + Intergenic
984622485 4:181969602-181969624 AAACAAATGCAAATGAGTTCAGG + Intergenic
989144101 5:38231564-38231586 TATCAAATACCAATGAGCACAGG + Intergenic
995194964 5:109356514-109356536 TCCCAAATCCCAAACACTTCTGG + Intronic
1004109973 6:12708171-12708193 TACCTAATCTCTATGAGTTTAGG + Intergenic
1005764192 6:28994707-28994729 TACAACATCCCTATGAGATCAGG - Intergenic
1008244690 6:49156590-49156612 CAGCAAATCCCTGTGAGTTCTGG - Intergenic
1009548351 6:65052187-65052209 TACCCAACCCCATTTAGTTCTGG + Intronic
1011453716 6:87524278-87524300 TACCAAATCCCAATGAGTTCTGG + Intronic
1015311966 6:131776189-131776211 TACCTATTCCCAAGGAATTCAGG - Intergenic
1015994228 6:138981313-138981335 TATCAAATCTCAATGAAATCTGG + Intronic
1017533648 6:155323613-155323635 TACCAAATTCCAATGAATTTAGG + Intergenic
1018238296 6:161747802-161747824 TACCAAATTCCATTAAATTCTGG - Intronic
1020499453 7:8898162-8898184 TACCATATCCAAATGTTTTCTGG + Intergenic
1027757043 7:82227180-82227202 TATCCATTCTCAATGAGTTCAGG + Intronic
1027781861 7:82530114-82530136 TACCTAATCCCAATCAGCCCAGG - Intergenic
1029197515 7:98816235-98816257 TGCCATATCCCCATGAGTTTGGG + Intergenic
1030876205 7:114816597-114816619 TAGCAAAGCTCAGTGAGTTCTGG + Intergenic
1031419617 7:121535255-121535277 TCCCAAAACCTAATGACTTCTGG - Intergenic
1037153102 8:15663075-15663097 TATAAAATCCTAATGAGTTTCGG - Intronic
1037372947 8:18199617-18199639 TCCCAAAAGCCAAAGAGTTCAGG - Intronic
1041024244 8:53667727-53667749 TAGCAAAGTCCATTGAGTTCAGG + Intergenic
1043621966 8:82204791-82204813 TCCCAAATTCCCATGTGTTCTGG - Intergenic
1044028822 8:87209891-87209913 TCCCAAATCCCCACGTGTTCAGG + Intronic
1044369513 8:91391954-91391976 TACCTACTCCCACTGAGTTTAGG + Intronic
1045109486 8:98926734-98926756 TCCCAAATCCCAATGTGCTTTGG - Intronic
1047058291 8:121192820-121192842 CACCTAATCCCATTGAGTTTTGG - Intergenic
1047536341 8:125723521-125723543 TACCAAATCTCACTGATTTTGGG + Intergenic
1049201360 8:141342094-141342116 TGCCAATTCCCAATGGGTCCTGG + Intergenic
1061889024 9:133608023-133608045 TACCAACCCCCAAAAAGTTCAGG - Intergenic
1062417893 9:136462498-136462520 TCCCAACTCCCAATGACTTCTGG + Intronic
1186323515 X:8454538-8454560 GAGGAAATCCCAATGAGGTCTGG + Intergenic
1188569625 X:31567548-31567570 TACTAAATCCCAGTTAGTTATGG + Intronic
1189544296 X:42025705-42025727 TGCCAAGTCCAAATGAATTCAGG - Intergenic
1193701616 X:84769557-84769579 TATCAAATCTCAATATGTTCTGG + Intergenic
1194969539 X:100327867-100327889 TTCCATATCACAATGATTTCAGG + Intronic