ID: 1011459688

View in Genome Browser
Species Human (GRCh38)
Location 6:87590104-87590126
Sequence CCGCGCGCCCTCGCGGCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 243
Summary {0: 1, 1: 0, 2: 3, 3: 26, 4: 213}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011459688_1011459692 -3 Left 1011459688 6:87590104-87590126 CCTGCAGCCGCGAGGGCGCGCGG 0: 1
1: 0
2: 3
3: 26
4: 213
Right 1011459692 6:87590124-87590146 CGGGAAATCCCGAGTGCATCTGG 0: 1
1: 0
2: 0
3: 3
4: 34
1011459688_1011459695 23 Left 1011459688 6:87590104-87590126 CCTGCAGCCGCGAGGGCGCGCGG 0: 1
1: 0
2: 3
3: 26
4: 213
Right 1011459695 6:87590150-87590172 ACGCAGAGTCAGTAAGACCATGG 0: 1
1: 0
2: 1
3: 7
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011459688 Original CRISPR CCGCGCGCCCTCGCGGCTGC AGG (reversed) Intronic
900287699 1:1909324-1909346 CCGTGCGTCCTAGCGGCGGCGGG - Intergenic
900298843 1:1966484-1966506 CCCCGGGCCCTCTCGGTTGCTGG - Exonic
900342230 1:2194659-2194681 CCGCGCCCCCGCCCGGCTCCCGG + Intronic
900972387 1:5998729-5998751 CTGCGCCCCCTCGCTGCTCCTGG - Intronic
901377393 1:8849075-8849097 CTGCGCCCCCTGGCGGCTGAAGG + Intergenic
902072199 1:13749546-13749568 CCTGCCGCCCTCGCTGCTGCTGG + Intronic
902350013 1:15847586-15847608 CCGCGCGCCTGCGCGCCGGCTGG + Intergenic
903628112 1:24745662-24745684 CCCGGCTCCCTCCCGGCTGCGGG + Intronic
904050447 1:27635110-27635132 ACGCCGGCACTCGCGGCTGCTGG - Exonic
905174022 1:36125197-36125219 CGGCCGCCCCTCGCGGCTGCCGG + Exonic
907501986 1:54887465-54887487 CCCCAGGCCCTCGGGGCTGCGGG + Intergenic
912715801 1:111982746-111982768 CCTAGCGTCCGCGCGGCTGCCGG - Exonic
915581101 1:156813922-156813944 CAGCGCCCACGCGCGGCTGCAGG - Exonic
916729525 1:167553637-167553659 CCGCGCGGGGTCGCGGCGGCCGG - Exonic
917310066 1:173669617-173669639 CTGCGATCCCTTGCGGCTGCCGG + Intronic
920912708 1:210233120-210233142 CCGCGCGCCCTCTTGGCACCAGG + Intronic
921260497 1:213381839-213381861 CCCAGCCCCCTCGCGCCTGCAGG + Intergenic
924561215 1:245156984-245157006 CAGCTCTCCCTGGCGGCTGCAGG + Intronic
1064982007 10:21174338-21174360 CCTCGCGCCACCGCCGCTGCAGG + Intergenic
1065099107 10:22316329-22316351 CCGCGCGCGCACGCGGCTCGGGG - Exonic
1065844763 10:29735679-29735701 CGGCGCGTCCTGGCGTCTGCCGG + Intronic
1066048481 10:31614954-31614976 CCCTGTGCCCTCACGGCTGCTGG + Intergenic
1067028704 10:42866121-42866143 CCCCGCGAGCTCGCGGCGGCCGG - Intergenic
1067112026 10:43407879-43407901 CCGCGCGCTCACGTGGCTGCAGG - Intronic
1068309890 10:55263517-55263539 CCTCTCCCCCTCGTGGCTGCTGG - Intronic
1070140238 10:73733152-73733174 CCGCGCGCCCACGGCCCTGCGGG + Intergenic
1070328585 10:75403043-75403065 CCGCGAGGACTCGCGGCGGCGGG - Intergenic
1073076218 10:100827126-100827148 CAGCGCGGCCGCGCGGCTTCTGG + Intronic
1074088344 10:110225883-110225905 CCGCACCCGCCCGCGGCTGCCGG - Intronic
1075700938 10:124469051-124469073 CCACTCGCCCCCGTGGCTGCAGG - Intronic
1075748464 10:124744100-124744122 CCGCGCGCACGCTCGCCTGCCGG + Intronic
1076117062 10:127907801-127907823 GCGGGCGCCCGCCCGGCTGCGGG - Intronic
1076792729 10:132785644-132785666 CCGCGCGCCACAGCGGCCGCGGG + Exonic
1077090859 11:777617-777639 CCGCGCGCCCGGGCGGTCGCAGG + Exonic
1077102877 11:829971-829993 CCGCCCGCCCTCCAGGCAGCGGG + Exonic
1077404506 11:2377191-2377213 CTGCGCGCCCTGGCGGCAGGAGG + Intronic
1081705654 11:45180857-45180879 CCGCGCGCCCCCGGCCCTGCTGG + Intronic
1082986082 11:59172363-59172385 CCGCGCGCCGCCGCCGCCGCCGG - Intronic
1083048141 11:59754935-59754957 CCGCGCAGCCTCAGGGCTGCTGG - Intronic
1083457104 11:62786684-62786706 CCGCGCCCCCTGGCGGCAGCGGG - Exonic
1085640282 11:78188914-78188936 CGGCGCGGCCCCGGGGCTGCGGG - Exonic
1087138117 11:94740513-94740535 CCGCGCGCCCTCGGGCCCCCGGG + Intronic
1090948526 11:131452253-131452275 CCCCGTGGCCTCCCGGCTGCAGG + Intronic
1093845387 12:23965014-23965036 ACGCGCCCCCTGGGGGCTGCTGG - Intergenic
1093894821 12:24563339-24563361 CCGCGCGTCCCCGCCGCCGCCGG + Intergenic
1094375386 12:29783691-29783713 CCGCACACCCTCCCGGCGGCGGG - Exonic
1100329514 12:93571006-93571028 TCGCGCGCACTCGCTGCTCCTGG + Intronic
1100869349 12:98894655-98894677 CCGCCAGCCCTCGCGGATCCCGG - Intronic
1104624355 12:130339201-130339223 CCGGGGGTCCTCGCGGGTGCTGG + Intronic
1105409764 13:20161530-20161552 CCGCGTCCCCAGGCGGCTGCAGG - Intergenic
1106087783 13:26558252-26558274 CTGCGCGCCCTCGCTGGTTCTGG + Intronic
1107133512 13:36920326-36920348 CCGCGCGCTCTGGCCGCTCCGGG + Intronic
1112506785 13:99980632-99980654 CCGCGCCCCCGCCCCGCTGCCGG - Intergenic
1113820386 13:113209096-113209118 CCGCGCGCTCCCGAGCCTGCAGG + Intronic
1113876729 13:113599441-113599463 CCTCGCCCCCTCCAGGCTGCTGG + Intronic
1115545629 14:34462572-34462594 CCGAGCGCCCGCTGGGCTGCGGG - Intronic
1116905205 14:50396989-50397011 CCGGCCGCCCTCCCGGCTGCAGG + Intronic
1117899251 14:60515563-60515585 GCGCGCGCCTCCGCAGCTGCAGG - Intergenic
1118808930 14:69260067-69260089 ACGCGCGCGCTCGGGGCTGAAGG + Exonic
1118869131 14:69726929-69726951 CGGCGCGCCCTTGCGGCCTCAGG - Exonic
1119106847 14:71932684-71932706 CCGCGCGTCCTCGCGGGCCCGGG + Exonic
1119261006 14:73237972-73237994 CCGGGAGCCCCAGCGGCTGCCGG + Intronic
1119487717 14:75002740-75002762 CCGCGCGCCCCCGCGCCTCGGGG - Intergenic
1119756755 14:77125138-77125160 CCGCGGGCTCTGGCGGGTGCCGG + Intronic
1120167816 14:81220161-81220183 CCGCCCTCCCTCCCGGCGGCCGG + Intronic
1121754473 14:96391761-96391783 CTGCGCGCGCTGTCGGCTGCTGG - Intergenic
1122779873 14:104139063-104139085 CCGCGAGCCGCCGCCGCTGCTGG + Exonic
1123024986 14:105420167-105420189 CCGCCCGCCCTCGCGGCCCCCGG + Intronic
1124129392 15:26971211-26971233 CCGCGCCCGCTCGCGGCTCCAGG + Intergenic
1124427132 15:29571197-29571219 CCTCGCGCCCTGGCGGCTGCAGG + Intergenic
1128529024 15:68431640-68431662 CCGTGCGCCCTCGGCGCTCCCGG + Intronic
1128972279 15:72118111-72118133 CCGCGCGACTCCCCGGCTGCAGG + Intronic
1128982458 15:72197539-72197561 CCGCGCGCCCAGGCGTCTCCCGG - Intronic
1129586849 15:76876044-76876066 CAGCGCACCCTCCCAGCTGCTGG + Intronic
1130023726 15:80252192-80252214 CAGAGCCCCCTCTCGGCTGCTGG - Intergenic
1131055343 15:89371542-89371564 CCCCGCGCCCTCGAGGCTGCGGG + Intergenic
1131969270 15:97875750-97875772 CCGCGCGCAGCCGCGGCTCCCGG - Intergenic
1132780395 16:1621295-1621317 CAGCGCACCCTCCCAGCTGCTGG - Intronic
1132843533 16:1989934-1989956 CCGCGCGTCCCCGCCGCGGCCGG + Exonic
1132900445 16:2251362-2251384 CCGCGCGCCGTCTCCGCCGCCGG + Exonic
1134012624 16:10866533-10866555 CCGGGGCCCCTCTCGGCTGCTGG - Intergenic
1136396154 16:29993609-29993631 CGGCGTGCCCTGGGGGCTGCAGG - Intronic
1138495123 16:57404164-57404186 TCGCGGGGCCTCGTGGCTGCTGG + Intergenic
1139341488 16:66270597-66270619 CAGCGCCCCCTGGCGGCTACGGG + Intergenic
1140096969 16:71883835-71883857 CCTCGCCCCCTCGCGGCCGCCGG - Intronic
1142413145 16:89926237-89926259 CACCGCCTCCTCGCGGCTGCGGG + Intronic
1142836928 17:2594047-2594069 CACCGCGCCCGGGCGGCTGCAGG + Intronic
1146126509 17:30235662-30235684 CCTCGCGCCCTCGAGGCACCCGG + Exonic
1146322630 17:31858906-31858928 CCGCGGGGCCGCGGGGCTGCGGG - Intronic
1147643535 17:42020014-42020036 CCGCGCTCTCTCTCCGCTGCCGG + Intronic
1147879825 17:43646299-43646321 CCGCGCCCCCTCCTGGCAGCGGG + Intronic
1148493419 17:48037666-48037688 CGGGGAGCCCTCGGGGCTGCGGG - Exonic
1148742802 17:49902256-49902278 CCGCACCCCCTTGCTGCTGCCGG + Intergenic
1151767530 17:76140080-76140102 GAGCGCGCCCCCGGGGCTGCAGG - Exonic
1151875960 17:76868496-76868518 CCGCGCGCTCTCTCGCCCGCTGG - Intronic
1153051921 18:908167-908189 GCGCGCGCCCCCTCGGCGGCCGG - Intronic
1153382251 18:4454000-4454022 CCGCGCTCGCCCCCGGCTGCAGG - Intronic
1154338643 18:13485387-13485409 CCACGTGCCCTCGTGGCTCCTGG + Intronic
1155003077 18:21704934-21704956 CCGCCCGCCCTCCCGGTGGCCGG - Intergenic
1158945734 18:62445482-62445504 CCCCGCCCCCTCCCAGCTGCAGG - Intergenic
1160754476 19:750544-750566 CCGGGCTCCCTCAGGGCTGCTGG - Intergenic
1160968604 19:1757571-1757593 CCGCGCGGCCCCGCGGCCGCGGG + Intronic
1161350070 19:3786392-3786414 CCGCGCGCCGCCGCCGCCGCCGG + Intronic
1161784091 19:6312290-6312312 CCGCCTGCCCTTGCCGCTGCAGG - Exonic
1163708543 19:18832061-18832083 CCGCGCGCCCCGGCGCCAGCCGG - Exonic
1163715183 19:18869127-18869149 CCGCGCGCACTGGCGGCCCCAGG + Exonic
1165333762 19:35155279-35155301 CCGCCGGCCCTTGCAGCTGCTGG + Exonic
1165871420 19:38975819-38975841 CCGCCCGCCCTCGCTCCCGCTGG - Exonic
1166014645 19:39970988-39971010 CGTCCCGCCCTCGCGCCTGCGGG + Exonic
1166106683 19:40601235-40601257 ACGCGCCCCCGCGCGGCCGCCGG + Intronic
1166706022 19:44908511-44908533 CCTCCCGCCCTCTCGGCCGCAGG + Exonic
1167109071 19:47448219-47448241 CAGCGTGCCCTCGCTGCGGCGGG + Exonic
1168345487 19:55648505-55648527 CCGCCCGCCCACGCGAGTGCGGG + Exonic
925344079 2:3157650-3157672 CCGCGGGCCTTCACGGCTGTAGG - Intergenic
926077349 2:9951812-9951834 TCGCGCCCGCTCGCCGCTGCCGG - Exonic
926077377 2:9951935-9951957 CCGCCCGCCCGCGCGGCCTCGGG - Intronic
928158114 2:28894896-28894918 CTGGGCGCCAGCGCGGCTGCAGG + Exonic
929252922 2:39779248-39779270 AGGCGCGCCCTCGCGCCTTCGGG + Exonic
929313591 2:40452235-40452257 GCGCTCGGCCCCGCGGCTGCCGG + Intronic
929452519 2:42047333-42047355 CCACGCGCGCTCGCAGGTGCTGG + Intergenic
931614617 2:64143933-64143955 CTGCGCGCCCCCGCTGCGGCGGG - Intronic
934588560 2:95526845-95526867 CCGCTCGGCCTAGCGGCCGCTGG + Intergenic
934966728 2:98730718-98730740 TCGCGCGCCCTCTCTGCGGCCGG - Intronic
935820098 2:106886201-106886223 GCGCGCACCCGAGCGGCTGCCGG - Exonic
938324922 2:130391780-130391802 CCTGGCGCTTTCGCGGCTGCTGG + Intergenic
938338917 2:130522796-130522818 CCGCGCGGCCGCGCTGCTGCAGG + Exonic
938350921 2:130597954-130597976 CCGCGCGGCCGCGCTGCTGCAGG - Exonic
940918899 2:159286582-159286604 CCGCGCGCCCCCGCTCCTGCAGG - Exonic
944967370 2:204950476-204950498 CCGCACGCCCTCGCATCTACTGG - Intronic
946227027 2:218269658-218269680 CCGCGCGCCCCCGCGGACCCCGG - Intronic
946326126 2:218985460-218985482 CCGCGCGTCTCCCCGGCTGCGGG - Exonic
946412638 2:219522737-219522759 CCGCCCGCCCCCGCGGCGGCCGG - Intronic
947521649 2:230850228-230850250 GTGCGCCCCCTGGCGGCTGCGGG + Intergenic
948140670 2:235670139-235670161 CCGCGCGGCATCGCGTCCGCGGG - Intronic
1169220593 20:3820253-3820275 CGGCGCCCCCTCGCGGCCGCCGG + Intergenic
1170999273 20:21396833-21396855 CCGCGCGCCCGCTCGGCCCCAGG + Intronic
1171010367 20:21506090-21506112 CAGCGCGCCCTGGCGCCTGGTGG + Intergenic
1172100574 20:32482579-32482601 GCGCGCGCCCTCGAGGCGGCCGG + Intronic
1173210724 20:41029362-41029384 CCGCGCGCGCTCGCCGCCGGAGG + Intronic
1173502593 20:43565116-43565138 GCTAGCCCCCTCGCGGCTGCCGG + Intronic
1175859621 20:62143363-62143385 CCGCGCGCACCCGCGACTCCCGG + Exonic
1177225268 21:18245229-18245251 CCGCGTGGTCTCGCTGCTGCTGG + Exonic
1179784054 21:43719692-43719714 CCGCCCGCCCCCGCGGCAGTTGG - Intronic
1179939007 21:44626425-44626447 CCGCCAGCCCTCGCCACTGCTGG - Intronic
1180699655 22:17774384-17774406 GCCCGCGCCCCCGCGGCTGGAGG - Intronic
1180959645 22:19756838-19756860 GCGCGCTCCCTCCGGGCTGCGGG + Intronic
1181574895 22:23787373-23787395 GCGCGCGCGCTCGGGGCTGTGGG + Intronic
1182045502 22:27270945-27270967 CAGCGCGTCCTCACGGCTGCAGG - Intergenic
1183821057 22:40346416-40346438 CCGGGCGCCCTGGGCGCTGCCGG - Intergenic
1184697955 22:46150369-46150391 CCGCGCGCCCTCCGGGCCCCGGG - Intergenic
1185255237 22:49827917-49827939 CCGCGCGTCATGGCGGCGGCGGG - Intergenic
956129111 3:66038120-66038142 CCTCGGGCCCTCGCCGCCGCCGG + Exonic
958814506 3:98901316-98901338 CGGCTCGCCATCGCGGCGGCCGG + Exonic
960269446 3:115658525-115658547 CCGCGAGCCCGCGCGGGTGGGGG - Intronic
961359428 3:126357569-126357591 CGGCCCGCCCGCGCGGCTCCCGG + Intergenic
961377517 3:126476236-126476258 CCGCTCGCCCTCGTAGGTGCCGG - Intergenic
961536682 3:127575146-127575168 CGGCGCCCCCGCGTGGCTGCCGG - Intronic
962263122 3:133927561-133927583 CGGGGCGCCCTCGGGCCTGCGGG - Intergenic
962817943 3:139019908-139019930 CCACGCGCGCTCGCCGCTCCCGG - Exonic
963081845 3:141402240-141402262 CCCCGGGCCCGCGGGGCTGCGGG + Intronic
966711925 3:182980446-182980468 CCGCCCGCCCTGCCGGCTGGGGG - Intronic
966794122 3:183697935-183697957 CCGTGCTCTCTCGCGGCGGCCGG + Exonic
966808585 3:183825010-183825032 CCACGCGACCTCGGAGCTGCCGG - Intronic
968230397 3:197002254-197002276 CTCCGCGCCCACGCGGCTCCCGG + Exonic
969788415 4:9475140-9475162 CCGGGCGCCCTCCGCGCTGCCGG + Intergenic
971756679 4:30717291-30717313 CGGGGCGCCCTTGCGGCGGCTGG - Intergenic
974549245 4:63349692-63349714 CCGCGCCCCCTCGCTGGTGGTGG - Intergenic
976053069 4:81031165-81031187 CCGTGCGCCCTCGCCCCAGCTGG + Exonic
981782880 4:148445562-148445584 CCGCGCGCCCCCGCGTCTCCTGG + Intergenic
982291695 4:153788826-153788848 TCGCGCGCCCACGATGCTGCAGG - Exonic
983919773 4:173333718-173333740 GCGCCCGCCCTGGCAGCTGCGGG - Intronic
985721678 5:1492874-1492896 CCAGGCACCCTCGCAGCTGCAGG - Intronic
985988338 5:3535841-3535863 CCGCGCTCCCTGGCTGCTCCCGG - Intergenic
986330774 5:6714488-6714510 CCGCGCGGCCCCGCGCCCGCCGG + Intergenic
989983095 5:50666612-50666634 CCGCGCACACTCGCGCCCGCGGG - Intronic
990373892 5:55150428-55150450 CCTCGCCCCCTGGGGGCTGCAGG - Intronic
992487591 5:77210878-77210900 CCGCCCGCGCCCGCGGCCGCCGG - Exonic
993905740 5:93621299-93621321 CCCCGCCCCCTCGCGGGCGCGGG + Intronic
996379035 5:122845508-122845530 CCGCGGGGCCCCGAGGCTGCGGG - Exonic
996862673 5:128083770-128083792 TCGCGCGCTCGCTCGGCTGCCGG + Exonic
997984430 5:138491823-138491845 CCCCGGGCCCTCGCAGTTGCAGG - Intergenic
999079091 5:148826510-148826532 CCTCGCCCCTTCGCGGCTGCCGG + Exonic
1002439625 5:179257548-179257570 CCCTGCGCCCTCCCCGCTGCTGG + Intronic
1006535699 6:34696960-34696982 CCGCGTGACCTCACCGCTGCGGG + Intergenic
1007633584 6:43285505-43285527 GCGCGCGTCCTCGCGGGTGCAGG - Exonic
1007644465 6:43369536-43369558 GAGCGCGCCCCCGCGGCTGGCGG + Intergenic
1008760352 6:54846476-54846498 CTGCCCGCCCTCGGGGCTACGGG - Intergenic
1011459688 6:87590104-87590126 CCGCGCGCCCTCGCGGCTGCAGG - Intronic
1013225741 6:108118491-108118513 CCGTGCGCCCGCCGGGCTGCGGG + Intronic
1013366195 6:109440361-109440383 CCGCGCCTCCTCGAGGCGGCGGG - Intronic
1014233979 6:118935031-118935053 CCGCGCGTCCCCGCGGCCGGTGG - Exonic
1014944052 6:127475953-127475975 CCGCGCGCTGTCGTGGCCGCCGG + Exonic
1016965885 6:149718174-149718196 GCGCGCTCCCTCGCAGCAGCCGG - Exonic
1017751460 6:157493311-157493333 CCGCTCGCCCTTGCGGTGGCTGG - Intronic
1018674328 6:166205979-166206001 GAGCGCGCCACCGCGGCTGCTGG + Intergenic
1018774213 6:166998864-166998886 CGGCGCCCCCCCGGGGCTGCAGG + Intergenic
1019525216 7:1477658-1477680 CCGCACGGCCTCCAGGCTGCAGG + Exonic
1019588516 7:1817306-1817328 CTGCGCGCCCGGGCGGGTGCTGG - Intronic
1020418205 7:7969441-7969463 CCGCCCGCCGTCGCCGCCGCCGG + Exonic
1022108438 7:27213370-27213392 CCCGGAGCCCTCGCGGCCGCGGG + Intergenic
1022410271 7:30134828-30134850 CCGGGCGCCCGCGGGGGTGCCGG + Exonic
1023810326 7:43906520-43906542 CCCTGCGCCCCCGCGGCTGCCGG - Intronic
1029460584 7:100691873-100691895 CCGCGCGCCCTGGCGCCTACTGG - Intergenic
1029550063 7:101232790-101232812 CCCCCCGCCCTCGGGGCAGCGGG - Intronic
1031052043 7:116954092-116954114 CCTCACGCCCTCCCGGCTGTGGG + Exonic
1032864372 7:135911214-135911236 CCGCGCTCCCTCCCAGCTGGTGG - Intergenic
1035833940 8:2728071-2728093 CCCCGCCCCCTCCCGGCTGTGGG + Intergenic
1036910790 8:12755462-12755484 CCGCGCGCCCGGGAGGCTCCGGG - Exonic
1037273746 8:17156547-17156569 CCGCGCCGGCTCGGGGCTGCGGG + Exonic
1038540376 8:28385917-28385939 CCCCGCGCGCCCGCGGCTGTCGG - Intronic
1038575735 8:28701888-28701910 CCGTTAGCCCTCCCGGCTGCCGG - Intronic
1041689898 8:60678696-60678718 GCGCGCGGCCCCGCGGCTTCGGG + Intergenic
1041690086 8:60679360-60679382 CCGCGCGCCCCCGCCGCCGCCGG - Intronic
1042591775 8:70403662-70403684 CCGCCCGCCCTCGCGGCCCCGGG + Intronic
1042903060 8:73747084-73747106 TCCCGCCCCCTGGCGGCTGCCGG + Intronic
1044734943 8:95269318-95269340 CCGCGAGCCCTCGTGGGCGCCGG - Intergenic
1046138463 8:110061079-110061101 CCCCGCGGCCTCGTGGCTGTTGG - Intergenic
1048981261 8:139704234-139704256 TGGCGCGCCCTGGAGGCTGCGGG - Intergenic
1049145983 8:141001300-141001322 CCGCGCGCGTGCGCGGCAGCCGG + Intronic
1049411443 8:142475627-142475649 CCGCCCGCACTCACGGCCGCAGG - Exonic
1049419547 8:142510758-142510780 CCGCGGGGCCTGGCGGCGGCGGG + Intronic
1049796857 8:144500959-144500981 CGGCGCTCACCCGCGGCTGCCGG - Exonic
1049802174 8:144522933-144522955 CCGCGTGCCCTTCCGGCTCCTGG - Exonic
1049802497 8:144524575-144524597 CCGCGCGCAGCCGCGCCTGCTGG - Exonic
1052970175 9:34372551-34372573 CAGGGCGCCATCGCGGCTGCAGG + Exonic
1055611581 9:78030936-78030958 CCGCGCGCCCGCGCGGGTGAAGG + Intronic
1055654934 9:78442220-78442242 CGGCGCACTCTCGCAGCTGCTGG - Intergenic
1056470727 9:86902799-86902821 CCGCGCGCCCCCGCAGAGGCCGG - Intergenic
1056992268 9:91423493-91423515 CCGCGCGCACTCGCCGCCGCTGG + Intronic
1057922078 9:99105446-99105468 CCGCGCGGCTCGGCGGCTGCCGG + Intronic
1058436498 9:104968543-104968565 CGGCGCGCATGCGCGGCTGCCGG + Intergenic
1060770253 9:126327054-126327076 CCGCCCGCCCTCCCGGCTGCAGG - Intronic
1060979622 9:127785127-127785149 CCGCGCCCCCTGGCGGCCGTCGG + Intergenic
1060996602 9:127877664-127877686 CTGCCCGTCCTCGCGGCGGCCGG + Exonic
1061540903 9:131277478-131277500 TCGGGCGCGCTCGCCGCTGCCGG + Intergenic
1061725959 9:132582201-132582223 CTCCGCGCCCTCGCCGCTCCGGG - Exonic
1062272235 9:135714808-135714830 CCGCGCGCCCCCGCAGCCGCCGG + Intronic
1062646627 9:137551363-137551385 GCCCGGGCCCTCCCGGCTGCAGG + Exonic
1185623195 X:1465853-1465875 CCGCGCGCCTCCGCTGCTCCCGG + Exonic
1189104246 X:38220462-38220484 CGGGGCGCCCTCGCGGCGACGGG - Intronic
1194127752 X:90040988-90041010 TCCCGCCCCCTGGCGGCTGCGGG + Intergenic
1198767163 X:140091576-140091598 CCGCGCGCCCGCCCGCCCGCAGG + Intergenic
1200418259 Y:2935454-2935476 CCGCGTGCCCCCGCGGCCGCGGG + Intronic