ID: 1011463441

View in Genome Browser
Species Human (GRCh38)
Location 6:87630487-87630509
Sequence ATTAACACCGGGCACATAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 116}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011463441_1011463445 -3 Left 1011463441 6:87630487-87630509 CCTATTATGTGCCCGGTGTTAAT 0: 1
1: 0
2: 0
3: 11
4: 116
Right 1011463445 6:87630507-87630529 AATCTAGGTTTTGAGAATACAGG 0: 1
1: 0
2: 1
3: 16
4: 211

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011463441 Original CRISPR ATTAACACCGGGCACATAAT AGG (reversed) Intronic
901763115 1:11483351-11483373 CTTAGCACCTGGCACATAGTAGG - Intronic
903007205 1:20306656-20306678 ATTTATGCCTGGCACATAATAGG - Intronic
903029740 1:20455189-20455211 GGGAACACCTGGCACATAATGGG - Intergenic
905290065 1:36915368-36915390 AACAAGACCTGGCACATAATTGG + Intronic
905971958 1:42148575-42148597 AACAATACCTGGCACATAATTGG - Intergenic
909520944 1:76566842-76566864 AATAATACCTGGCACAAAATAGG + Intronic
917675443 1:177314682-177314704 AATAACACCGGACACATAGTGGG - Intergenic
918504659 1:185238724-185238746 TTTTAAACCGGGCAGATAATAGG + Intronic
920992258 1:210950708-210950730 ATTACCACCGGCCACTTATTGGG + Intronic
923281402 1:232446170-232446192 ATTAACACCTGGCACAGCAGAGG + Intronic
924328512 1:242919972-242919994 AATAGCACCTGCCACATAATAGG - Intergenic
1064223855 10:13465088-13465110 ATTCACTGCTGGCACATAATAGG + Intronic
1073003939 10:100307149-100307171 CTTAACACAGGACACGTAATAGG - Intronic
1075934550 10:126328227-126328249 CCTAGCACCTGGCACATAATAGG + Intronic
1079548624 11:21666946-21666968 AATAACACTTGGCACATAGTTGG - Intergenic
1080183453 11:29451066-29451088 TTTAGCACCTGGCACATAGTAGG + Intergenic
1086540073 11:87898562-87898584 CCTAACACCTGGCACATACTAGG + Intergenic
1090615840 11:128514022-128514044 TATAACACCTGGCACATAGTGGG + Intronic
1091810266 12:3391158-3391180 AACAGCACCGGGCACATAATAGG - Intronic
1095153598 12:38825088-38825110 ATTCACACTGGGGAAATAATAGG - Intronic
1096124153 12:49107416-49107438 ATTTACTCCGAGCACATTATTGG + Intronic
1101581442 12:106045394-106045416 TTAAACACCAGGCACATAATTGG - Intergenic
1103419983 12:120772719-120772741 ATTAGCACCGTGCACACAGTAGG - Intronic
1103501083 12:121402570-121402592 ATTAACACAGGGCACCAATTTGG - Intronic
1107687440 13:42917701-42917723 ATTAGCACCGGGCCTATAGTAGG - Intronic
1109082909 13:57929950-57929972 AATAGCACCTGGCACATAATAGG + Intergenic
1109422020 13:62126550-62126572 ATCAACAACAGACACATAATTGG - Intergenic
1111240243 13:85464443-85464465 AATAACACTTGGCACATAGTAGG - Intergenic
1115993549 14:39173405-39173427 AATAGCACCTGGCACATAGTGGG + Intergenic
1120305262 14:82761694-82761716 ATTTACACTGAGCCCATAATGGG - Intergenic
1124786248 15:32683580-32683602 TAGAACACCCGGCACATAATAGG - Intronic
1125211787 15:37225476-37225498 ATCAGTGCCGGGCACATAATAGG - Intergenic
1134376976 16:13685995-13686017 ATTAACAATAGGCACTTAATTGG + Intergenic
1135050270 16:19186853-19186875 AGAAATGCCGGGCACATAATAGG - Intronic
1137234350 16:46601895-46601917 ATTGACACCCTGCACATAGTAGG + Intronic
1137848643 16:51716023-51716045 AACCACACTGGGCACATAATAGG - Intergenic
1138703066 16:58885501-58885523 AATAACACCTGGCAAATAGTAGG - Intergenic
1142610258 17:1105570-1105592 ATTAAAAACTGGCACAGAATTGG + Intronic
1148825060 17:50386831-50386853 AATAACCCCTGGCACATAGTAGG - Intronic
1156807973 18:41209798-41209820 CTTAGTACCTGGCACATAATTGG + Intergenic
1157755625 18:50214719-50214741 ATGAACACCGAGCACATGGTTGG - Intergenic
1158004646 18:52658428-52658450 AATAACCCTGGGCACATTATGGG + Intronic
1158706000 18:59792741-59792763 TTTAACACAGGGCACAGAGTAGG - Intergenic
1162770663 19:12947624-12947646 AACAGCACCTGGCACATAATGGG + Intronic
1162934451 19:13974538-13974560 CCTAACACCGGGCAGATAAGAGG + Intronic
1164490304 19:28705507-28705529 ATTAATACCCTGCACATAGTAGG + Intergenic
1166018930 19:40007028-40007050 TTTAACTGCAGGCACATAATGGG + Intronic
1166643539 19:44514215-44514237 GTTAACACCTGGCACATACTAGG + Intronic
1167254898 19:48421539-48421561 CTTAACACCTGGCACATCAGGGG + Intronic
931991846 2:67798068-67798090 ATTATCACTGGGCAGATAAAAGG + Intergenic
932822505 2:74913305-74913327 ATTAACATTGGTCTCATAATTGG + Intergenic
937038929 2:118806236-118806258 ATCAACACCGGGCACGAATTGGG + Intergenic
937858395 2:126689346-126689368 AATAACACCAGGCACCTCATAGG + Intronic
937858900 2:126692957-126692979 ATTAACACCAGGCACCTCATAGG + Intronic
938179185 2:129164260-129164282 ATTAACTCCTGCCACCTAATGGG - Intergenic
939067109 2:137496847-137496869 TCTAAGACCGGGCACATGATAGG - Intronic
939387900 2:141525169-141525191 TTTAACACCTGGCACATGAGTGG + Intronic
940335450 2:152522326-152522348 AATAATACTGGGCACATAGTAGG + Intronic
941444046 2:165579009-165579031 ATACATACCTGGCACATAATAGG + Intronic
941648975 2:168072626-168072648 ACTAAGACAGGGCACATAGTAGG + Intronic
942183756 2:173404861-173404883 ATAAATACCTGGCACATAGTAGG - Intergenic
943969703 2:194387364-194387386 ATTAAAACTGGGAACAAAATAGG + Intergenic
945565919 2:211399168-211399190 ATTCACATGGGGCATATAATGGG - Intronic
946270812 2:218591933-218591955 AGTTATACCGGGCACATAGTAGG + Intronic
1168935828 20:1664721-1664743 ATCAGCACCGGGAACATAACAGG - Intergenic
1169767332 20:9161185-9161207 ATAAACAGCTGGTACATAATGGG + Intronic
1178265629 21:31140749-31140771 AATGACACCAGGCACATAGTGGG - Intronic
1184936810 22:47730648-47730670 AAGAAGACCTGGCACATAATAGG - Intergenic
951409210 3:22341856-22341878 ATTAATGCCAGGCACATAGTAGG + Intronic
955500275 3:59576369-59576391 AATAGCACCTGGCACATACTAGG - Intergenic
956023658 3:64959000-64959022 TTTAACACCAGGCAGAGAATTGG + Intergenic
956035302 3:65084439-65084461 ATTAATGCCTGGCACATAGTAGG - Intergenic
958476193 3:94586183-94586205 ATTCATTCCTGGCACATAATAGG - Intergenic
962656231 3:137546358-137546380 ATTAAAATCGAACACATAATTGG + Intergenic
964702468 3:159584343-159584365 CTTTCCACAGGGCACATAATTGG - Intronic
966307585 3:178554024-178554046 CATAACACCTGACACATAATAGG - Intronic
966347086 3:178991854-178991876 AATAATGCCTGGCACATAATAGG + Intergenic
969526639 4:7707193-7707215 AACAGCACCTGGCACATAATAGG - Intronic
970203997 4:13637938-13637960 TACAACACCTGGCACATAATAGG - Intergenic
972532019 4:39969803-39969825 CTTAATGCCTGGCACATAATTGG - Intronic
973012724 4:45096288-45096310 AATAATTCCTGGCACATAATAGG + Intergenic
974805868 4:66879918-66879940 TTTAGAACCTGGCACATAATAGG - Intergenic
976416813 4:84785635-84785657 AATGTCACCTGGCACATAATAGG + Intronic
979155737 4:117387594-117387616 AATAATACCTTGCACATAATGGG + Intergenic
981528524 4:145731472-145731494 ATTAATATGGGGCACATATTTGG + Intronic
983049669 4:163031230-163031252 ATTAACACACGGCAAAAAATAGG + Intergenic
983103276 4:163652884-163652906 AACAACACCAGGAACATAATTGG - Intronic
985977824 5:3435092-3435114 ATTAACTCCGTGACCATAATAGG + Intergenic
986551025 5:8955826-8955848 ATTCAAACAGGGCACATCATAGG - Intergenic
987903361 5:24043421-24043443 ATTAATACCTGGCACATTACAGG + Intronic
992347028 5:75889717-75889739 ATAAAACCCTGGCACATAATAGG + Intergenic
992763328 5:79971160-79971182 ATAAATACCAGGCACATAGTGGG + Intergenic
993434583 5:87876069-87876091 AATAGCACCTAGCACATAATAGG + Intergenic
993757372 5:91748622-91748644 AATAAAACCGACCACATAATTGG - Intergenic
993929909 5:93925429-93925451 ACTAATACTGGGCAAATAATGGG - Intronic
994745271 5:103669791-103669813 AACAGCACCTGGCACATAATAGG + Intergenic
998778666 5:145631652-145631674 AATAATACCTGGCACATAATGGG + Intronic
1001055227 5:168443866-168443888 AAGAATACCTGGCACATAATTGG - Intronic
1001662095 5:173401758-173401780 ATGCACACCTGGCACATAGTAGG - Intergenic
1003130513 6:3391580-3391602 ATTTGCACCTGGCACAGAATGGG - Intronic
1003816673 6:9849416-9849438 ATTAATACCTGGCACATTAGAGG - Intronic
1004316716 6:14594630-14594652 CTTAGCATCTGGCACATAATAGG + Intergenic
1007166278 6:39831122-39831144 ATTACTACCTGGTACATAATAGG - Intronic
1007560638 6:42805594-42805616 AATAGCCCCTGGCACATAATAGG - Intronic
1011463441 6:87630487-87630509 ATTAACACCGGGCACATAATAGG - Intronic
1013728501 6:113132670-113132692 CTTAAGGCCTGGCACATAATAGG + Intergenic
1016002717 6:139058456-139058478 AACAATACCAGGCACATAATAGG + Intergenic
1016620280 6:146101418-146101440 TTTAACAATGGGTACATAATGGG - Intronic
1020723966 7:11785556-11785578 ATTAACAGCAGGCAAAAAATGGG - Intronic
1028074246 7:86492198-86492220 TCTAACACCTGGCACACAATTGG - Intergenic
1032242902 7:130179201-130179223 ATTAACACCTGGAACAGACTAGG + Intronic
1038478070 8:27882871-27882893 AATAGCACCTGGCACATAATAGG + Intronic
1038712865 8:29964298-29964320 AAGAATACCTGGCACATAATTGG + Intergenic
1042661287 8:71157447-71157469 ATCAACACCTGACACATAGTAGG + Intergenic
1044110531 8:88267544-88267566 CGTAACACCTGGCACATAGTGGG + Intronic
1045089772 8:98729686-98729708 AATAACACCTGGCACATAAGTGG - Intronic
1045225140 8:100236750-100236772 CCTAACACCTAGCACATAATTGG - Intronic
1047907554 8:129488818-129488840 AATAGCACCTGGCACATAATGGG - Intergenic
1048050966 8:130815859-130815881 ATAAACACATGGCACATAGTAGG + Intronic
1048412786 8:134192931-134192953 ATTAATACCTGGCACATAGTTGG + Intergenic
1048803068 8:138212183-138212205 ATGGACACCTGGCACAAAATAGG + Intronic
1052444229 9:28539305-28539327 AATAGTACCTGGCACATAATAGG + Intronic
1185763407 X:2705736-2705758 TTTAACACCGGGCAGACGATCGG - Intronic
1186991662 X:15076015-15076037 CTCAACACTTGGCACATAATAGG + Intergenic
1188208288 X:27387070-27387092 ATTCACACCTGGCACATGTTGGG + Intergenic
1188264848 X:28060325-28060347 AGTTACACCTGGCACATATTTGG - Intergenic
1192179674 X:68908696-68908718 CATAACACCTGGCACATATTAGG - Intergenic
1201225899 Y:11818980-11819002 AATAGCACCTGCCACATAATAGG - Intergenic