ID: 1011465074

View in Genome Browser
Species Human (GRCh38)
Location 6:87646991-87647013
Sequence GGCAAGAAGAGGTCTGATTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 269
Summary {0: 1, 1: 0, 2: 3, 3: 34, 4: 231}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011465074 Original CRISPR GGCAAGAAGAGGTCTGATTC TGG (reversed) Intronic
900666452 1:3818478-3818500 GGCGAGAAGTGGTCAGATTCTGG - Intronic
900683678 1:3933101-3933123 GGCAGGAAGAGCTCTGAGCCAGG + Intergenic
901878478 1:12180544-12180566 GGCCAGGGCAGGTCTGATTCTGG - Intronic
903774968 1:25787207-25787229 GGGAAGGAGAGGGCTGCTTCAGG - Intergenic
904257876 1:29267915-29267937 GGGGAGAAGTGGTCAGATTCTGG + Intronic
905188842 1:36217203-36217225 GGGAAGAAGAGTTCGGTTTCTGG + Intergenic
906210491 1:44010103-44010125 GGCAGGGAGAGGTCTGGCTCAGG + Intronic
907660088 1:56383890-56383912 GGCACGAAGAGGTCAGGTTGGGG - Intergenic
907703956 1:56816924-56816946 GGCTAGAAGTGGTCAGATGCTGG - Intronic
907816310 1:57921609-57921631 GGCAAGAAGTGATCTGATTCTGG - Intronic
909498411 1:76305409-76305431 GGCAAGAGGAGATGTGATTATGG + Intronic
910810216 1:91227989-91228011 GGCAAGAAGGGGTGTTTTTCAGG + Intergenic
911455758 1:98121249-98121271 GGAAAGAATAGGCCTGAATCTGG - Intergenic
912302193 1:108529712-108529734 GGTGAGAAGAGGTCACATTCTGG - Intergenic
913206352 1:116542714-116542736 GGCAAGAGGAGGTGGGATCCAGG + Intronic
913975224 1:143450378-143450400 GCCACGAAGAGGTCTGACACAGG + Intergenic
914069617 1:144275994-144276016 GCCACGAAGAGGTCTGACACAGG + Intergenic
914109538 1:144690360-144690382 GCCACGAAGAGGTCTGACACAGG - Intergenic
914824314 1:151130740-151130762 AGCAAAAAGAGGTCAGACTCTGG + Intergenic
915980119 1:160415289-160415311 GGCATGAAGAGGGCAGGTTCTGG - Intronic
918185406 1:182122305-182122327 GGGAAGAAGATGTCTGAGTGAGG - Intergenic
918354734 1:183696850-183696872 GGCAAGAATTGGTCAGATTCTGG - Intronic
918375624 1:183906353-183906375 GGCAGATAGAGGTCTGAATCTGG + Intronic
920362595 1:205429660-205429682 GGCTAGCACAGGTCTGTTTCTGG + Intronic
921527811 1:216239792-216239814 GGCAAGAAGTGGTCAAATTCTGG + Intronic
924140910 1:241022363-241022385 GGCAAGAAGAGGGTTGGTTGCGG - Intronic
1065804621 10:29383115-29383137 GGTGAGAAGTGGTCTGACTCTGG + Intergenic
1066678533 10:37913863-37913885 GCCAAGAAAAGGTCTCATCCAGG - Intergenic
1069480467 10:68777155-68777177 CGTAAGAAGTGGACTGATTCTGG - Intronic
1070123043 10:73597232-73597254 GGCAAGAAGAGGGTTTGTTCTGG - Intronic
1070694671 10:78552966-78552988 GGCAAGAAGAGATCAGATCAGGG + Intergenic
1071845099 10:89513885-89513907 GGAAAAAAGAAGTCAGATTCTGG + Intronic
1076582140 10:131518807-131518829 GGTAAGAAGATGTCAGATGCTGG - Intergenic
1076700990 10:132272607-132272629 GGCAAGATGCGGTCGGAGTCTGG - Intronic
1077884986 11:6380751-6380773 GGCAAGAAGAGGCATGATCATGG + Intergenic
1078366456 11:10710641-10710663 GGTAAGAAATGGTCAGATTCTGG - Intergenic
1078834282 11:15012124-15012146 GGCAGGAAGCGGTTTGTTTCGGG + Intronic
1079024626 11:16936591-16936613 GGAGAGAAGAGGCATGATTCGGG - Intronic
1079260155 11:18870927-18870949 GGCAAGGAGGAGTCTGTTTCAGG + Intergenic
1079287707 11:19153934-19153956 GGTAAGAAGGGGTCAGATTCTGG - Intronic
1080219644 11:29886489-29886511 GGTAAGAAGTGTTTTGATTCTGG - Intergenic
1080490409 11:32756925-32756947 AGCAAGAACAGATCTTATTCAGG - Intronic
1081003700 11:37706774-37706796 GGCAAGAAGAGTTGGTATTCAGG - Intergenic
1082726868 11:56746824-56746846 GGGGAGAAGTGGTCAGATTCAGG - Intergenic
1083766867 11:64845427-64845449 GGCAAGGAGAGGTCTGAGATAGG + Intergenic
1083790387 11:64980978-64981000 GAAAAGAAGTGGTCGGATTCAGG - Intergenic
1084891051 11:72237419-72237441 GGCAGGAAGATGGCTGAGTCCGG - Exonic
1084995069 11:72968542-72968564 GGCAAGAAGAGTTCCTCTTCAGG - Intronic
1085735469 11:79035140-79035162 CACAAGATGAGGTCTGAATCCGG + Intronic
1085767876 11:79299342-79299364 GGCAAGCAGAGGCCTGGTCCCGG - Intronic
1089708192 11:120295915-120295937 GGTAAGAAGATGGCTGTTTCAGG - Intronic
1089880609 11:121769816-121769838 GGTGAGAAGGGGTCAGATTCTGG - Intergenic
1090678486 11:129027976-129027998 GGCAAGAAAAAGACTGATTAGGG + Intronic
1090742149 11:129674091-129674113 GACAAGAAGTGGTAGGATTCGGG + Intergenic
1091002560 11:131922597-131922619 GGTAAAAAGTGGTCTGATTCAGG - Intronic
1092056998 12:5515748-5515770 TCCATGAAGAGGTCTGAGTCAGG - Intronic
1092938394 12:13385467-13385489 GGCAGGAAGAGGTCTGTTGTAGG + Intronic
1094068707 12:26389036-26389058 GGTGAGAAGTGGTCAGATTCTGG - Intronic
1094080455 12:26529006-26529028 GGCAAGAAGTTGTAGGATTCTGG - Intronic
1094626906 12:32132925-32132947 GGTAAGAAGTGATCTGATTCAGG + Intronic
1095199397 12:39364827-39364849 GGGAAGAAGAGGTTTGTTTCAGG - Intronic
1096113450 12:49041790-49041812 GGCCAGAAGGGATCTGCTTCTGG - Intronic
1097903445 12:64896375-64896397 GGTAAGAAGTGGTCAGATTCTGG + Intergenic
1098605967 12:72389947-72389969 GGTAAGAAGGGGGCAGATTCTGG + Intronic
1104223645 12:126810503-126810525 GGTGAGAAGAGCTCTGATTCTGG + Intergenic
1104675222 12:130707783-130707805 AGCAAGAAGAGCTCAGAATCAGG + Intronic
1106777305 13:33020702-33020724 GGGGAGAAGTGGTTTGATTCTGG - Intronic
1108071951 13:46637210-46637232 GACAAGAAGTGGTCACATTCAGG - Intronic
1108076809 13:46689131-46689153 AGCAAGAAGGATTCTGATTCGGG + Exonic
1109913523 13:68948870-68948892 GGAAAGAAGTGGTTTGAATCTGG - Intergenic
1110451905 13:75646257-75646279 GGCAAGAGGTGGTCAGATTCTGG - Intronic
1114196937 14:20486412-20486434 AGTAAGAAGAGGTTGGATTCTGG + Intergenic
1115546201 14:34466692-34466714 GGCAAGAAGGGTTCTGTTGCAGG + Intergenic
1116007353 14:39309102-39309124 GGTAAAAAGTGGTCAGATTCAGG - Intronic
1118891806 14:69916288-69916310 GGCAAGAAGCGGGTAGATTCTGG - Intronic
1119236454 14:73024180-73024202 TGCCAGAAGAGGACTCATTCTGG - Exonic
1124068737 15:26371305-26371327 GGCAGGAAGTGGTTGGATTCTGG - Intergenic
1126257878 15:46649352-46649374 GGCACAAAGAGGTATGATTGGGG + Intergenic
1126498171 15:49315780-49315802 TGCAAGAAGAGAACAGATTCAGG + Intronic
1126988666 15:54344803-54344825 GGTGAAAAGTGGTCTGATTCTGG - Intronic
1127420271 15:58798413-58798435 GGCAAGAAAAGGTCTGGGTGTGG - Intronic
1127830142 15:62743388-62743410 GGGAAGAAAAGGTTTGCTTCTGG + Intronic
1128629944 15:69254568-69254590 GGTGAAAAGAGGTCAGATTCTGG + Intronic
1130445629 15:83998726-83998748 GGCAAGAAGGGGCCTGATCAAGG - Intronic
1133866221 16:9646071-9646093 GGCAGGCAGAGTTATGATTCTGG - Intergenic
1138770926 16:59662700-59662722 GGAAAAATGAGGTCAGATTCTGG + Intergenic
1139510467 16:67425386-67425408 GCCAAGAAAAGGCCTGAATCAGG + Intergenic
1140058782 16:71549240-71549262 GGTGAGAAGTGGTCTGATTCAGG - Intronic
1141200129 16:81891365-81891387 GGGAAGAACAGCTCTGATGCGGG - Intronic
1144087714 17:11825888-11825910 GTCAAGAAAAGTCCTGATTCTGG - Intronic
1144409038 17:14982044-14982066 GGCAAGAAGACCTGAGATTCAGG + Intergenic
1145843433 17:28016289-28016311 GGCAAGAAGAGGTTGAATTCAGG + Intergenic
1146210360 17:30937663-30937685 GGTTAGAAGTGGTCAGATTCTGG + Intronic
1147047752 17:37767387-37767409 GCCAAGAAGTGGTCAGATCCTGG - Intergenic
1148745378 17:49915157-49915179 GGCAAGAAGAGGCCAGAGGCAGG - Intergenic
1149284102 17:55142894-55142916 TTCCAGAAGAGGTCTGATTCTGG - Intronic
1151061652 17:71101364-71101386 GGAATCAGGAGGTCTGATTCAGG + Intergenic
1154065882 18:11106595-11106617 GTAAAGAAGAGGTCTCATTATGG + Intronic
1154428279 18:14288811-14288833 GGCAAGGAGATGTCTCATACGGG - Intergenic
1156902795 18:42321057-42321079 GGCAAGAAGGGGTTTTATTTTGG - Intergenic
1158159278 18:54461908-54461930 GGTAAGAACAGGTTTGAGTCAGG - Intergenic
1158523199 18:58188932-58188954 GGAGAGAAGATCTCTGATTCAGG - Intronic
1159626442 18:70700693-70700715 GGTAAGATGATGTCTTATTCTGG + Intergenic
1162429965 19:10622490-10622512 GGTGAGAAGAGGTTGGATTCTGG + Intronic
1166857152 19:45788104-45788126 GGTGAGAGGAGGTCAGATTCTGG - Intronic
1167026720 19:46925055-46925077 TGCAAGAAGTGGTCGGCTTCCGG + Intronic
1167414565 19:49363254-49363276 GGGAAAAGGAAGTCTGATTCTGG + Intronic
1167555622 19:50193356-50193378 GGCAAGAAGGGGTCGGATTCTGG + Intronic
925704582 2:6671884-6671906 GGCCAGAAGAACTGTGATTCAGG + Intergenic
926127992 2:10283599-10283621 GGCGAGTAGTGGTCTGATGCAGG - Intergenic
928586237 2:32761294-32761316 GGTAAGAAGCAGTCTGATTCTGG - Intronic
928784436 2:34865357-34865379 GGTAATAAGAGGTCAAATTCTGG + Intergenic
929461943 2:42108810-42108832 GGCAAGAAGTGGTTGGATTCTGG - Intergenic
929851635 2:45596862-45596884 GGCCAGAAGATGTCTACTTCAGG - Intronic
930597132 2:53402549-53402571 GGCAAGAAGTGATCAGATTTTGG + Intergenic
930646293 2:53912375-53912397 GGCAAGAAGAGATCAAATTATGG - Intronic
931206977 2:60157171-60157193 GGCATGAAGAGGTCTGTTTGTGG - Intergenic
931496261 2:62810408-62810430 GGGAAGAAGAGTCCAGATTCTGG + Intronic
933278526 2:80306858-80306880 GGCAAGAAGAGGTCCCACTTTGG + Intronic
933449503 2:82429181-82429203 GGAAAGATGAGGTTTGAATCAGG - Intergenic
934290220 2:91685612-91685634 GCCACGAAGAGGTCTGACACAGG + Intergenic
934506069 2:94895643-94895665 GCCGAGAAGAGGTCTGTTTAGGG - Intergenic
936037518 2:109124762-109124784 GGCAAGAAGAAATCTGATACAGG - Intergenic
939686447 2:145206382-145206404 GGAATGAAGATGTCAGATTCTGG - Intergenic
941885427 2:170522697-170522719 AACAATAAGAAGTCTGATTCTGG - Intronic
942164439 2:173228365-173228387 GGCAAGAAGAGAGGTGATTCCGG - Intronic
942489424 2:176474848-176474870 GGCAAGAAGTGGGCAGATTCTGG + Intergenic
942619132 2:177829028-177829050 GGTAAGAAGTGGTCAGATTCTGG + Intronic
946084258 2:217155246-217155268 GGCAGGAAGGGGCCTGAATCAGG - Intergenic
946261191 2:218492630-218492652 GGTAAAAAGAGGTCACATTCTGG + Intronic
947332265 2:229042568-229042590 GGCAAGAAGAGGGCTGAGGGAGG + Intronic
948765616 2:240217244-240217266 GGCAAGCAGAGGTCAGGGTCAGG + Intergenic
1168967337 20:1906801-1906823 GGTAAGAAGAGGTCAGGGTCTGG + Intronic
1170487420 20:16832906-16832928 GGAGAGAAGAGGTCAGATTCTGG - Intergenic
1170976884 20:21173242-21173264 GGTAAGAAGTGGTCAGATTCTGG + Intronic
1172525569 20:35599152-35599174 GTCTACAAGAGGTCTGAGTCAGG - Intergenic
1173849594 20:46209644-46209666 GGTGAGAAGTGGTCAGATTCTGG + Intronic
1184273561 22:43398154-43398176 GTCAAGCAGAGGTCTGGCTCAGG + Intergenic
1184282146 22:43443314-43443336 GGGAGGACAAGGTCTGATTCGGG + Intronic
950008759 3:9707460-9707482 GGGGAGAAGTGGTCAGATTCAGG + Intronic
950171999 3:10845170-10845192 GGTAAAAAGAAATCTGATTCTGG + Intronic
950193884 3:10995510-10995532 GGCAAGAAGTGGCCTGATATTGG - Intronic
951941678 3:28086435-28086457 GGAAAGAAGAGGTTTGATCAAGG + Intergenic
952717512 3:36494967-36494989 GGAAAGCAGAGGTCAGACTCAGG - Intronic
952909910 3:38174686-38174708 GGTGAGAAGTGGTCAGATTCTGG + Intronic
954160559 3:48718615-48718637 GGCAAGAAGTGATTTCATTCTGG - Intronic
954759012 3:52860713-52860735 GGGGAGAAGAGGTCAGATTCCGG + Intronic
955058080 3:55473936-55473958 GGCAAGGAAAGGTCTTTTTCAGG + Intronic
955295295 3:57729366-57729388 GGGGAGAAAAGGTCAGATTCTGG + Intergenic
956390024 3:68761829-68761851 AGGAAGAAGAGGTTGGATTCTGG + Intronic
956488045 3:69742028-69742050 GGTAAGAAGCGGGCAGATTCTGG - Intronic
957242888 3:77681881-77681903 GGCAAGAAGAGGGCTTGTTTTGG - Intergenic
958193825 3:90217612-90217634 GGTAAGAAGTGGTCAGATTCTGG - Intergenic
958417181 3:93888661-93888683 GGTAAGAAGTGGTCAGATTCTGG - Intronic
959357992 3:105356097-105356119 GGCAATAAGACTTCTGTTTCTGG + Intergenic
959520880 3:107321763-107321785 GGAGAGAAGAGGACTGATTTGGG + Intergenic
959593440 3:108103653-108103675 AGCAAGAAGGGGTCAGATACTGG + Intergenic
960954383 3:123021468-123021490 GGAAAGAAGAGGCCTGAGTTGGG + Intronic
961114370 3:124316169-124316191 GGCAATAAGAGGCCAGATTCTGG - Intronic
961426028 3:126848971-126848993 TGCAGGACGAGGTCTGATTTTGG + Intronic
961455417 3:127021523-127021545 GACAGGAAGAGGTTTGATTAGGG - Intronic
961837142 3:129671733-129671755 GGCAAGAATAGGTATGTTACTGG + Intronic
963000816 3:140680046-140680068 TGCAAGAACAGGCCTGATTTTGG + Intronic
963410366 3:144920079-144920101 GGAAAGAAATGGACTGATTCTGG - Intergenic
963453226 3:145511634-145511656 GGAAAGAAGTGGTCAGATCCTGG - Intergenic
963724876 3:148908731-148908753 AGTAAGAATAGGGCTGATTCTGG + Intergenic
965660568 3:171037606-171037628 GGTAAGATGTGGTCAGATTCAGG - Intergenic
966412951 3:179662078-179662100 GGCAGGAAGAGATTTGATACAGG - Intronic
967844784 3:194034943-194034965 GGCAAGAAGACCTCTGACTTGGG + Intergenic
967881288 3:194303530-194303552 GGCAAGAAGGGGTCTGTGTGTGG + Intergenic
969111429 4:4846783-4846805 GGAAAGCAGAGGTGTGATGCTGG - Intergenic
970480517 4:16468289-16468311 GGCAAGATAAGGCCTGATTCGGG + Intergenic
971282300 4:25250829-25250851 GGCAAGAGGTGGTTGGATTCTGG + Intronic
971489392 4:27195119-27195141 GGTGAGAAGTGGTCAGATTCTGG + Intergenic
974133611 4:57787477-57787499 GGTAAGAAGTGGTCAGATTTGGG + Intergenic
974356175 4:60815640-60815662 GGTAAGAAGTGGTTAGATTCTGG - Intergenic
978994498 4:115132817-115132839 GGCAAAGAGAGGGCTTATTCAGG - Intergenic
979480001 4:121205652-121205674 GGAAAGAAAAGGTGGGATTCTGG + Intronic
980700532 4:136423061-136423083 GGCAAGAAGTGGTCAGATATTGG + Intergenic
981831015 4:149001938-149001960 GGTAAGAAGTGGTCAGATTCTGG - Intergenic
983918311 4:173315940-173315962 GGCAACAAGGGATCAGATTCTGG - Intronic
984112957 4:175643089-175643111 GGGAAGAATCGGTCTGATTATGG - Intronic
984781966 4:183534121-183534143 GGAAAGAAGACGACTGAATCTGG - Intergenic
985774182 5:1832046-1832068 GGCACCAAGAGGGCTGCTTCAGG + Intergenic
987236806 5:15950770-15950792 GGTGAGAAGTGGTCAGATTCTGG + Intergenic
988398816 5:30734079-30734101 GGGAAGGAGAGTTCTAATTCTGG - Intergenic
988507421 5:31835918-31835940 GGAAATAATAGGACTGATTCAGG - Intronic
988906703 5:35798055-35798077 GGGAAGAAGTGGTCTCATTCGGG - Intronic
990781553 5:59370067-59370089 GGCGAGAAGTGATCAGATTCTGG - Intronic
991645067 5:68793098-68793120 AGCAAGAAGAGGTCCCAATCTGG - Intergenic
992367354 5:76106249-76106271 GGCAAGAAGTGGTTACATTCTGG - Intronic
993342959 5:86747429-86747451 GGCAAAAAGAGCTCTTCTTCTGG + Intergenic
993776371 5:92003048-92003070 GGCCTGAAGATTTCTGATTCTGG + Intergenic
994247729 5:97499744-97499766 GGCAAGATCATGCCTGATTCAGG - Intergenic
998684346 5:144506727-144506749 GGCAAAAAGGGGTTTGTTTCGGG - Intergenic
999524746 5:152392403-152392425 GGAAAGAAGAGATCACATTCTGG + Exonic
1000091686 5:157935037-157935059 GGCAAGAAGCGGTTTGTTTTGGG + Intergenic
1000371049 5:160537055-160537077 GGCAAGAAGTGATCAGATTCAGG - Intergenic
1002111882 5:176921271-176921293 AGCAAGAAGCGTTCAGATTCAGG - Intronic
1002537431 5:179885003-179885025 TGTAAGAAGGGGTCAGATTCAGG - Intronic
1006546030 6:34782350-34782372 GACCAAAAGAGGTCTGTTTCGGG + Intergenic
1007251172 6:40496176-40496198 GGTAAGAAGGGGTTGGATTCGGG - Intronic
1007381275 6:41491751-41491773 GGTGAGAAGTGGTCAGATTCTGG + Intergenic
1008086460 6:47250339-47250361 GGGAAGAATAGCTATGATTCTGG + Intronic
1008302340 6:49856408-49856430 GGAAGGAAGAAGTCTTATTCAGG + Intronic
1010537991 6:77054699-77054721 GGCAAAAGGAGGTATGTTTCAGG + Intergenic
1011465074 6:87646991-87647013 GGCAAGAAGAGGTCTGATTCTGG - Intronic
1011587592 6:88943424-88943446 GGTGAGAAGTGGTCAGATTCTGG - Intronic
1011598628 6:89039897-89039919 GGCAAGAAGTGGTGAAATTCAGG - Intergenic
1013091470 6:106904548-106904570 GGTGAGAAGTGGTCAGATTCTGG - Intergenic
1013581848 6:111542812-111542834 GGAAAGTAGTGGTCAGATTCTGG + Intergenic
1015589043 6:134804917-134804939 GCCAAGAAGAAGTCTCATTTTGG + Intergenic
1017232299 6:152085985-152086007 GGCAAGAAAAGGTAGGATCCAGG + Intronic
1018883321 6:167907081-167907103 TGCAAGCAGAGATCTGATACAGG - Intronic
1018992252 6:168683088-168683110 GGAAGGAAAAGCTCTGATTCTGG - Intergenic
1019602696 7:1893232-1893254 GGCAACAAGAGGTTTGGTCCCGG + Intronic
1020579039 7:9971392-9971414 TCCAAGAAGAAGTCTGCTTCAGG + Intergenic
1021297275 7:18923529-18923551 GGTAAGCAGAGGACAGATTCAGG - Intronic
1023759717 7:43453284-43453306 GGTGAGGAGTGGTCTGATTCTGG + Intronic
1024255838 7:47539487-47539509 GGCAGGAGGAGGTCAGAGTCGGG - Intronic
1025023419 7:55497370-55497392 GGGAAGAAGAGCTCTGCTTCTGG - Intronic
1026084197 7:67249375-67249397 GGCAAGAAGAGTTTTGCTTTGGG + Intergenic
1026559346 7:71435374-71435396 GGCAAGAGGAGGTTTGTTTTGGG - Intronic
1026624199 7:71977967-71977989 GGCATGAAGAGGGATGATTTTGG - Intronic
1028777213 7:94691667-94691689 GGTAAGATGAGGTCTTATTGTGG + Intergenic
1028923668 7:96334367-96334389 GGCAAGAACAGGTCTCAGGCTGG - Intergenic
1029067954 7:97871707-97871729 GCCGAGAAGAGGTCTGTTTAGGG - Exonic
1031234069 7:119149150-119149172 AGCAAAAAGATGTCTGCTTCAGG - Intergenic
1031454826 7:121966032-121966054 GATAAGAAGAGGTCTGATTAGGG + Intronic
1031624800 7:123980058-123980080 GGTGAGAAGTGGTCAGATTCTGG - Intergenic
1034516696 7:151586458-151586480 GCGGAGAAGAGGTCTGATTTCGG - Intronic
1037363212 8:18095778-18095800 GGTGAGAAGTGGTCAGATTCGGG - Intergenic
1042475281 8:69241806-69241828 GTCAAGAAGAGGTGTGAGCCTGG + Intergenic
1043864874 8:85363454-85363476 GGCAAGAAGAGCTCAGAGTGTGG - Intronic
1044211842 8:89559989-89560011 GGTGAGAAGTGGTCAGATTCTGG - Intergenic
1045159846 8:99526489-99526511 GGTGAGAAGTGGTCAGATTCTGG + Intronic
1045686715 8:104720209-104720231 GGCAAGAAGTGGTTTGATTCTGG + Intronic
1045954169 8:107887681-107887703 GGAAAGAAGTGGTTGGATTCAGG - Intergenic
1046009440 8:108528500-108528522 GACAAGAAGAGGTGAGAGTCGGG + Intergenic
1046444358 8:114297390-114297412 GGCAAGAAGGGGTGGGATTAAGG - Intergenic
1047112804 8:121809537-121809559 ACCAGGAAGAGGTCTGATCCAGG - Intergenic
1047870690 8:129078253-129078275 GGCAGAAAGAGCTCAGATTCAGG + Intergenic
1048045237 8:130766799-130766821 GGCAAAAAGTGGTCAGACTCAGG - Intergenic
1049217974 8:141416486-141416508 GGCAAGAATGGGTCAGCTTCAGG - Intronic
1052383961 9:27803285-27803307 GAAAAGAAGAGGGCAGATTCAGG + Intergenic
1053536099 9:38927874-38927896 AGTCAGAAGTGGTCTGATTCAGG - Intergenic
1054630037 9:67436078-67436100 AGTCAGAAGTGGTCTGATTCAGG + Intergenic
1056890753 9:90489452-90489474 GGTAAGAAGAGGTTAGATTTAGG - Intergenic
1057457739 9:95229417-95229439 GGTAGGAAGTGGTCAGATTCTGG + Intronic
1057988009 9:99737428-99737450 GGGAAGAAGTGGTAAGATTCTGG - Intergenic
1058150586 9:101459484-101459506 GGCAGGAAGAGGACTCATTTGGG + Intergenic
1059657482 9:116369583-116369605 GCCAAGAAGATCTCTGATACTGG - Intronic
1059705468 9:116819252-116819274 GACAAGAACATGGCTGATTCTGG + Intronic
1061069880 9:128302796-128302818 GGTGAGAAGTGGTCAGATTCTGG + Intergenic
1062160549 9:135077274-135077296 GGCAAAGAGATGGCTGATTCTGG + Intronic
1187067603 X:15855400-15855422 GGGAAGGAGAGGGCGGATTCCGG - Intergenic
1187328280 X:18312239-18312261 GGCAAGAAGTGGTTGGATTTTGG + Intronic
1187498156 X:19814212-19814234 GGTGAGAAGTGGTCAGATTCTGG - Intronic
1187567895 X:20470677-20470699 GGCAGGAAGAGGGGTGATCCAGG + Intergenic
1187967593 X:24627781-24627803 GGTAAGAAGTGGTCAGATTCTGG + Intronic
1188088523 X:25933386-25933408 TTCAAGCAGAGGTCTGATTAGGG - Intergenic
1190472949 X:50800882-50800904 GGCAGGAAGAAGCCTCATTCTGG - Intronic
1192348308 X:70331726-70331748 GGAAAGCAGAGGACTGATCCAGG + Intronic
1192543614 X:71995168-71995190 GGTAACAAGTGGTTTGATTCTGG - Intergenic
1194461530 X:94175586-94175608 GGTAAGAAGTGGTCAGATTCTGG + Intergenic
1195084367 X:101400376-101400398 GGAAGGAAGTGGGCTGATTCAGG + Intronic
1196469084 X:116005092-116005114 GGAAAGGAGAAGTCTGAATCAGG + Intergenic
1198265227 X:135002687-135002709 GCCAGGAAGTGGTCAGATTCTGG + Intergenic
1201562417 Y:15332226-15332248 GGCAAAAAGAGGGCTTATGCAGG - Intergenic