ID: 1011466066

View in Genome Browser
Species Human (GRCh38)
Location 6:87658571-87658593
Sequence ATCTACTTCATTAGGTCAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 113}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011466066 Original CRISPR ATCTACTTCATTAGGTCAGG TGG Intronic
903439072 1:23373741-23373763 ACCTAGTTCATGAGGTCAGAGGG + Intergenic
903516578 1:23915139-23915161 ATATAATTCATTGGGCCAGGTGG - Intergenic
907853450 1:58278799-58278821 ATCTCCTTCATCAAGTCAGCAGG + Intronic
910675971 1:89817246-89817268 AGCTACCTTTTTAGGTCAGGTGG - Intronic
912139444 1:106704168-106704190 ATCTTCTTCAGTAGGTGAGTGGG - Intergenic
1066052537 10:31648794-31648816 GTCTATTTCATTAGGGAAGGTGG + Intergenic
1067932997 10:50582317-50582339 ATCTCCTTCATTAAGTCATTTGG + Intronic
1069750166 10:70740326-70740348 CTCTTCTTCATTAAGTCAAGAGG - Intronic
1069765423 10:70853561-70853583 ATAAACTTCATGAGGACAGGAGG + Intronic
1074066572 10:110020269-110020291 ATAAACTGCATTAGGGCAGGAGG - Intronic
1075425930 10:122341719-122341741 ACCTACTTCATGGGGTCGGGAGG - Intergenic
1083743175 11:64721870-64721892 ATCTATTTCATTATTCCAGGTGG + Intronic
1087999526 11:104859486-104859508 ATGTACTTCCTCAGGTCAGCTGG - Intergenic
1090859665 11:130641514-130641536 AAATACTTCACTAGGACAGGAGG - Intergenic
1103877270 12:124137941-124137963 ATCTAGTTCTTTAGGTAAGAAGG - Intronic
1107354002 13:39546518-39546540 TTCTGATTCACTAGGTCAGGTGG - Intronic
1108335610 13:49438407-49438429 ATCTTCAACATAAGGTCAGGTGG - Intronic
1111159379 13:84373643-84373665 ATCTATGTCATTGGGGCAGGGGG - Intergenic
1111264815 13:85795224-85795246 CTTTACTTAATTTGGTCAGGTGG + Exonic
1117969040 14:61234301-61234323 GACTACTGCATTAGGTAAGGGGG + Intronic
1123880273 15:24672556-24672578 AGCTACTTCACTGGGTGAGGCGG - Intergenic
1127472461 15:59302505-59302527 ATCTAACTCATGAGGCCAGGAGG + Intronic
1130894476 15:88159596-88159618 GTCTACTTCTTTAGGGCAGAGGG - Intronic
1135004638 16:18808872-18808894 ATCTACTAGATTAGGTAAAGGGG + Exonic
1135156315 16:20055909-20055931 ATCTACTTCATAGGGTTAGAAGG + Intronic
1142170933 16:88622448-88622470 ATGTACCTCACTGGGTCAGGTGG + Intronic
1142771622 17:2101742-2101764 ATCTACTTCATGAGGTTGTGGGG - Intronic
1146565636 17:33910611-33910633 ATAAACTTCATGAGGGCAGGGGG + Intronic
1148844579 17:50521803-50521825 ATCTACAGCAATGGGTCAGGAGG + Intronic
1149745717 17:59095829-59095851 AGCTACTTCAGAGGGTCAGGTGG - Intronic
1155814566 18:30289177-30289199 TTCTAATTCAGTAGGTCAGTAGG - Intergenic
1158612645 18:58956373-58956395 ATCTCCTTCATTCTCTCAGGAGG - Intronic
1165015018 19:32874571-32874593 ATCTATTTCACCTGGTCAGGAGG - Intergenic
927316935 2:21694549-21694571 ATCCAATTCATTAGTTAAGGGGG - Intergenic
929670688 2:43874851-43874873 AGCTACTTGATCTGGTCAGGGGG + Intronic
930324406 2:49897238-49897260 ATCTTCTACTTTAGTTCAGGAGG - Intergenic
930758318 2:55002528-55002550 GTTTACTTCATTAGTTCATGTGG + Intronic
930767735 2:55102286-55102308 AACTACTACTTTAGGCCAGGGGG + Intronic
930788329 2:55295836-55295858 ACCTACTTCATTAGTTCTGCGGG - Exonic
932248395 2:70217864-70217886 ATCTACCTCATTAGGGCTGTCGG - Intronic
932883862 2:75529255-75529277 ATCTCATTTCTTAGGTCAGGTGG - Intronic
935621209 2:105131335-105131357 AGCTGCTGCATTAGGTGAGGTGG - Intergenic
939171514 2:138701558-138701580 ATTTGCTTCTTTGGGTCAGGTGG + Intronic
939338507 2:140862652-140862674 AGCTACTTCAGTAGATCAGGAGG - Intronic
940491366 2:154365577-154365599 ATCTATTTCATAAAGTAAGGTGG + Intronic
940746582 2:157574391-157574413 TTTGACTTGATTAGGTCAGGAGG - Intronic
1170009151 20:11702086-11702108 ATCTAACTCATTATGCCAGGAGG + Intergenic
1173146462 20:40528973-40528995 CTCAACTTCCTTTGGTCAGGAGG - Intergenic
1173882322 20:46424936-46424958 TTCTGCTTCAGTAGGTCTGGAGG - Intronic
1174346042 20:49930685-49930707 ATCAATTCCATGAGGTCAGGAGG - Intergenic
1176972994 21:15288309-15288331 ATCAACTTGACTAGGTCAAGGGG + Intergenic
1180927786 22:19568070-19568092 TTCTACTTGAATAGGGCAGGTGG + Intergenic
950887887 3:16376578-16376600 AGCTACTTCATGAGGGCAGCAGG + Intronic
952585948 3:34892490-34892512 ATGTACTTCATGAGGTCTTGTGG - Intergenic
955160022 3:56455994-56456016 CTCTAATTCCCTAGGTCAGGAGG - Intronic
955562334 3:60205202-60205224 ATCTAATTCATTATGTCCAGTGG - Intronic
956665586 3:71639198-71639220 TTCTGATTCAGTAGGTCAGGGGG + Intergenic
956884995 3:73550251-73550273 TTCTGGTTCATTAGGTCTGGGGG - Intronic
957118144 3:76054279-76054301 ATTTAGTTCTTTAGGTCAGATGG + Intronic
959930444 3:111976606-111976628 ATCTGCTGCCTTAGTTCAGGGGG - Intergenic
960944147 3:122954498-122954520 CTCTGCTTCATGAGGGCAGGAGG + Intronic
961941490 3:130642086-130642108 ATTTGCTTCAGGAGGTCAGGGGG + Intronic
966356349 3:179083344-179083366 AGCTACTTCAATTGGTCAGCTGG + Intergenic
969622324 4:8284782-8284804 AACTACTTGCCTAGGTCAGGCGG - Intronic
971843524 4:31888248-31888270 ATGTACTTGATTAGCTGAGGTGG + Intergenic
972344508 4:38181805-38181827 ATCTACTTTATTAGTTTAAGTGG + Intergenic
972867747 4:43255635-43255657 AACTGCTTCATTATGACAGGAGG + Intergenic
974500427 4:62693291-62693313 TTCCACTTCATAATGTCAGGAGG + Intergenic
974940218 4:68458960-68458982 ACCTAGCTCATTAGGTTAGGAGG + Intronic
978133874 4:105233401-105233423 AGCTACTGCAGTAGATCAGGAGG + Intronic
978233357 4:106427765-106427787 TTCTAATTCAATAGGTCTGGAGG + Intergenic
979097821 4:116573498-116573520 ATCTACTTTCTGAGGTCTGGAGG + Intergenic
984897601 4:184555528-184555550 ATCTACTTGTTTAAGTCAGTTGG + Intergenic
985481117 5:111453-111475 ATCTCCTTCCTTATGTCGGGCGG + Intergenic
986808027 5:11327157-11327179 GGCTACTGCATTGGGTCAGGTGG + Intronic
988453446 5:31365912-31365934 AGGTACTTCATTAGAGCAGGAGG - Intergenic
990561327 5:56986255-56986277 ATCTAGTGCATTAAGTCAGCAGG + Intergenic
991436446 5:66601093-66601115 ATCTACTGCATTAGTACACGTGG - Intronic
992623565 5:78616861-78616883 TTCTCCTTAATTAGGGCAGGTGG - Intronic
992748970 5:79844627-79844649 ATCTTCTTCAGGAGGGCAGGTGG + Intergenic
995683672 5:114747359-114747381 ATCTACATCATAAGGTTATGTGG + Intergenic
999757439 5:154675341-154675363 ATCAACTTCACAAGGTCATGGGG - Intergenic
1004269066 6:14177709-14177731 ATTTAGTGCATTAGGCCAGGTGG - Intergenic
1004642322 6:17527238-17527260 AGCTACTTCATTTGGCCAGAAGG - Intronic
1008800179 6:55358801-55358823 ATGTCTTTCATTAGGTGAGGGGG + Intronic
1011466066 6:87658571-87658593 ATCTACTTCATTAGGTCAGGTGG + Intronic
1011986589 6:93454826-93454848 CTCTTCTCCCTTAGGTCAGGGGG + Intergenic
1016001938 6:139050501-139050523 ATGGAATTCATTAGGTCAGTAGG - Intergenic
1016495802 6:144660452-144660474 AATTACTTCCTTTGGTCAGGAGG + Intronic
1018469059 6:164080410-164080432 ATCTCCTTCAGTTGGTCAAGAGG + Intergenic
1019489747 7:1306737-1306759 ATGAGCTTCATGAGGTCAGGGGG - Intergenic
1020388842 7:7636524-7636546 ATCTACTTCATTTTGTAAGTAGG + Exonic
1020584382 7:10047821-10047843 ATCAAATTCAAAAGGTCAGGAGG + Intergenic
1022993568 7:35731496-35731518 AATTACTTCATGAGGTAAGGAGG - Intergenic
1024161404 7:46680266-46680288 ATCCACTTGTTTAGGTCAGCAGG - Intronic
1026402872 7:70033673-70033695 ATCTTCTGCATTATATCAGGAGG + Intronic
1027817005 7:82988125-82988147 ATCTACTTCAGAAGCTGAGGTGG - Intronic
1028590285 7:92485764-92485786 ATCTCCTCCATTCTGTCAGGAGG + Intergenic
1030879020 7:114853143-114853165 ATCTACTTCCTTTGGTTAGGAGG - Intergenic
1031426363 7:121610361-121610383 ATGTACTTCATTAGGCAAGCTGG - Intergenic
1039132474 8:34282163-34282185 ATCTGCTTAATTAGAACAGGAGG - Intergenic
1040668624 8:49659458-49659480 ATCTACTGCACTGGGTCAGAGGG - Intergenic
1042878685 8:73463669-73463691 ATGTACTTCATTTGGGGAGGAGG + Intronic
1044826809 8:96206430-96206452 ATCTACTTCATAAAGTTATGAGG - Intergenic
1047310983 8:123691749-123691771 ATCTGATTCAGTAGGTCTGGTGG + Intronic
1047646143 8:126872198-126872220 AACTACCTCATTAGGTCTTGGGG + Intergenic
1048544121 8:135370212-135370234 CTCTACTTCAGTTGCTCAGGTGG + Intergenic
1053089800 9:35264695-35264717 ATTTACTTCATTATGTAAGAGGG + Intronic
1056507386 9:87270137-87270159 TTCTACTTGATTAGGGCTGGAGG - Intergenic
1186065834 X:5763564-5763586 AAATACTTCATTAGGTTAAGTGG - Intergenic
1186422463 X:9437308-9437330 ATCCACTTGACTAGGTCATGGGG - Intergenic
1187248709 X:17577184-17577206 ATCTACTTCATTAAGACACTAGG - Intronic
1187787052 X:22903571-22903593 ATCTATTTCATTAGGGCTGTAGG + Intergenic
1188260230 X:28015522-28015544 ACGTACTTCATTTGGTCAGCAGG - Intergenic
1198681964 X:139192451-139192473 TTCTAATTCAGTAGGTCAGCGGG + Intronic
1200765054 Y:7073857-7073879 ATCTACTTCATTTTTTGAGGTGG + Intronic