ID: 1011468620

View in Genome Browser
Species Human (GRCh38)
Location 6:87685564-87685586
Sequence CTGATAATACAAGTGAAGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 171}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011468620_1011468622 16 Left 1011468620 6:87685564-87685586 CCAAGCTTCACTTGTATTATCAG 0: 1
1: 0
2: 0
3: 15
4: 171
Right 1011468622 6:87685603-87685625 TAATCATATGCCTTCCTATTTGG No data
1011468620_1011468623 25 Left 1011468620 6:87685564-87685586 CCAAGCTTCACTTGTATTATCAG 0: 1
1: 0
2: 0
3: 15
4: 171
Right 1011468623 6:87685612-87685634 GCCTTCCTATTTGGCTTATGAGG 0: 1
1: 0
2: 0
3: 7
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011468620 Original CRISPR CTGATAATACAAGTGAAGCT TGG (reversed) Intronic
900007071 1:65924-65946 TTTATAATACCAGTGAAACTTGG + Intergenic
902273251 1:15321093-15321115 CTAAAAATACAAGTTTAGCTGGG - Intronic
905955881 1:41995386-41995408 CTGATAATACAATTCTAGATTGG - Intronic
907582713 1:55586385-55586407 CTTAGGGTACAAGTGAAGCTGGG + Intergenic
908343763 1:63210135-63210157 CTGATATTCCAAGGGAAGCTTGG - Intergenic
909193031 1:72578683-72578705 ATGGTAATAAAAATGAAGCTGGG - Intergenic
909483367 1:76149056-76149078 CAGATAATTCATGTAAAGCTTGG + Intronic
916431398 1:164732337-164732359 CTGAGAATCCATGTGAAGTTGGG - Intronic
916874804 1:168958018-168958040 CAGTAAATACAAATGAAGCTTGG + Intergenic
918558055 1:185829217-185829239 CAGAAAATACAATTGAAGCCTGG + Intronic
922125035 1:222713191-222713213 CTTATAATACAAGCTAAACTGGG + Intronic
923449295 1:234101475-234101497 CTATTAATACAAGTTAATCTGGG + Intronic
923640493 1:235754518-235754540 CTGAAAAGACAGGTGAGGCTGGG - Intronic
1068229074 10:54147306-54147328 ATGAAAATAAATGTGAAGCTAGG + Intronic
1068259909 10:54566262-54566284 CTGATAATACAAGTTATGCATGG - Intronic
1068701203 10:60021997-60022019 CTGATTTTTCAAGAGAAGCTTGG + Intergenic
1076700496 10:132270353-132270375 GTGATACCACAAGTGAAGCACGG + Intronic
1078497602 11:11834911-11834933 CAGATAAGAAAACTGAAGCTTGG + Intergenic
1078659287 11:13273849-13273871 CTGCTCATCCCAGTGAAGCTGGG + Intergenic
1080855651 11:36109347-36109369 CGGATAAGACACGTGAAGGTGGG + Intronic
1084455686 11:69266923-69266945 CTGTAAATACAGATGAAGCTTGG - Intergenic
1085500174 11:77014188-77014210 CTGATGAGAAAATTGAAGCTTGG - Intronic
1086968918 11:93059328-93059350 CTGATAATCTCAGTGCAGCTAGG - Intergenic
1087822668 11:102729685-102729707 CTGAAAATACAAAATAAGCTGGG + Intergenic
1091359626 11:134966412-134966434 TTGATAAAAAAAATGAAGCTTGG + Intergenic
1092926874 12:13279464-13279486 CTTATAATACAAGTCATGCTTGG + Intergenic
1093478019 12:19575970-19575992 CTGATAATATCACTGAAGCCTGG + Intronic
1094794751 12:33958490-33958512 CTGATCCTACAGGAGAAGCTTGG + Intergenic
1095106601 12:38241117-38241139 CTGATCCTACAGGAGAAGCTTGG + Intergenic
1095646616 12:44555839-44555861 CTGATAAAATAAGGGAAGCAGGG - Intronic
1096183037 12:49561147-49561169 CTGAGAATTCAAGTTCAGCTGGG + Intronic
1096335439 12:50751814-50751836 CTGAAAATACAAATTCAGCTGGG + Intergenic
1097483124 12:60157151-60157173 CTATTAATACAAGGGAATCTGGG + Intergenic
1098984038 12:76991111-76991133 CTAATAAGAAAAGTGAAGTTTGG - Intergenic
1101252970 12:102953335-102953357 TTGATATTAAAAGTGAAACTAGG - Intronic
1101268793 12:103120583-103120605 TTGATAAGAAAAGTGAAGCATGG - Intergenic
1104628189 12:130377082-130377104 CTAATGATACCAGTGAAGCTGGG - Intergenic
1106431745 13:29687468-29687490 CTAGTAATACAATTTAAGCTGGG - Intergenic
1106645291 13:31627992-31628014 ATCAGAATACAAGGGAAGCTGGG + Intergenic
1106760467 13:32862587-32862609 CTGATAAGAAAAGGGAGGCTGGG + Intergenic
1108639333 13:52368140-52368162 CTAAAAATACAAGTTACGCTGGG + Intergenic
1110212630 13:72991402-72991424 CTGATTATACAACTGAAACTTGG - Intronic
1115179413 14:30605055-30605077 CTGAAAATACAAAATAAGCTGGG - Intronic
1118930523 14:70236107-70236129 GTGATATCACAAGTGAAGCAGGG + Intergenic
1120492303 14:85193011-85193033 CTGTTACTACAAGAGAGGCTGGG - Intergenic
1125914296 15:43471817-43471839 CAGGTAATACAAGTGAAGTTTGG - Intronic
1126036669 15:44552719-44552741 CTGATAATACAAAATTAGCTGGG - Intronic
1128161273 15:65424095-65424117 CTGATAGGGCAAGTGAAGATGGG - Intergenic
1130968890 15:88717365-88717387 GAGATAACACAACTGAAGCTTGG - Intergenic
1132155127 15:99490613-99490635 CTGAAAATACAAGGCTAGCTGGG - Intergenic
1134244291 16:12528498-12528520 CTGATTTTTCAAGAGAAGCTAGG - Intronic
1134379043 16:13707402-13707424 CTGTAAATACAGATGAAGCTTGG - Intergenic
1137770143 16:51009656-51009678 CAGATAAGAAAACTGAAGCTCGG - Intergenic
1138964019 16:62061967-62061989 ATTATAATACATGTGAAACTAGG + Intergenic
1141350178 16:83287401-83287423 CTGTAAATACAGATGAAGCTTGG - Intronic
1143085699 17:4414318-4414340 CTGAGATTACAGGTGTAGCTGGG - Intergenic
1146018752 17:29255917-29255939 CTGATAAAATAAGTAAATCTGGG + Exonic
1150180316 17:63112346-63112368 CTGTTAATCCAAGGGAATCTAGG + Intronic
1150455865 17:65305995-65306017 CTGTAAATACAGATGAAGCTTGG + Intergenic
1155003220 18:21706240-21706262 CTGAAAATACAAGATTAGCTGGG - Intronic
1155367005 18:25058719-25058741 CTGTAAATACAGATGAAGCTTGG + Intergenic
1155748950 18:29396297-29396319 CTTAGAATCCAAGTGAACCTGGG - Intergenic
1158533680 18:58287045-58287067 CTGATAATACTTGAGAAACTAGG + Intronic
1160638826 19:107508-107530 TTTATAATACCAGTGAAACTTGG + Exonic
1161835083 19:6640453-6640475 CTTATAAAACAAATGAATCTGGG + Intergenic
1162503237 19:11066668-11066690 CAGATGACACAAGTGGAGCTCGG + Intergenic
1165809288 19:38601108-38601130 CTAAAAATACAAAAGAAGCTAGG - Intronic
1167029323 19:46946874-46946896 TTGAAAATAAATGTGAAGCTGGG - Intronic
1167031662 19:46966051-46966073 CTGGATGTACAAGTGAAGCTAGG - Intronic
1168470095 19:56632845-56632867 CTGATAATAGACATGGAGCTTGG - Intergenic
926182203 2:10654893-10654915 CTTTCAATACAAGTTAAGCTGGG - Intronic
926807162 2:16721707-16721729 CTGATAAGGCAACTGAGGCTAGG + Intergenic
930260688 2:49142679-49142701 CTGTTAATTCAAGTGAAACAAGG + Intronic
930714582 2:54581232-54581254 ATGATAATACAAGTGTAGAATGG + Intronic
930991891 2:57666180-57666202 ATTATAATACTAGTGAGGCTAGG + Intergenic
932989517 2:76769443-76769465 GTGATAATATAAGCTAAGCTGGG + Intronic
933701656 2:85259337-85259359 AAGATAATACAAATGAAGGTTGG - Intronic
936905946 2:117536011-117536033 CTTATAATACCTGTGGAGCTGGG + Intergenic
938691315 2:133792099-133792121 AAGATAATACAAGACAAGCTCGG + Intergenic
938737008 2:134194911-134194933 CTGATAATGCAGTTGAAGTTGGG + Intronic
938872889 2:135499746-135499768 CTGTTGATACAAGTAAAGATTGG + Intronic
938977598 2:136494706-136494728 CTGAGAAAACAAAAGAAGCTTGG + Intergenic
944342688 2:198621918-198621940 CTGATAAAACATTTCAAGCTAGG + Intergenic
946826933 2:223688919-223688941 CTGGTAAAACAAGTGGAGCTGGG - Intergenic
948165069 2:235854673-235854695 CAGATAAAGCAAGTCAAGCTCGG - Intronic
1169148747 20:3272522-3272544 CTGAAAATCCTAATGAAGCTGGG - Intronic
1169924703 20:10770459-10770481 CAGATGATAAAAGTGAGGCTTGG - Intergenic
1171005426 20:21460885-21460907 CTGAAAATACAAAAGTAGCTGGG + Intergenic
1172370188 20:34383525-34383547 CTGATAATACAAAATTAGCTGGG - Intronic
1177996013 21:28098720-28098742 CTGAAAATACAAAAGTAGCTGGG - Intergenic
1178475062 21:32930892-32930914 CTGTAAATACAGATGAAGCTTGG + Intergenic
1178600838 21:33993147-33993169 CAGATAACACAAGTGAGGCTGGG - Intergenic
1178737464 21:35165975-35165997 CAGATAAGAAAAATGAAGCTCGG - Intronic
1181829582 22:25549258-25549280 CTGTAAATACAGATGAAGCTTGG - Intergenic
949659389 3:6260459-6260481 CTAATAATAAAAGAGAAACTTGG - Intergenic
950236928 3:11330550-11330572 GGGAAAATACAAGAGAAGCTTGG - Intronic
950412961 3:12850900-12850922 CTGACAAGACCAGGGAAGCTGGG + Intronic
951304783 3:21045420-21045442 ATGATAATACAGGTAAAACTAGG - Intergenic
951477206 3:23119502-23119524 CTGAGAGTGCAAGTGATGCTGGG - Intergenic
952460391 3:33519013-33519035 CTGATAATAAAACTGCACCTTGG - Intronic
954726930 3:52620147-52620169 TGGATAATACAAGGGAAGTTAGG + Intronic
954930446 3:54276630-54276652 CTGATTGTACAAGAGAAGTTTGG + Intronic
955056302 3:55458776-55458798 CAGCTAATACAAGCAAAGCTTGG + Intergenic
958133196 3:89455972-89455994 CTGGTAATACGAGAGAAGCATGG - Intronic
958867201 3:99515281-99515303 CTTAAAAAACAAGTGAGGCTGGG - Intergenic
960143491 3:114173640-114173662 GTGATCATACAGGAGAAGCTGGG - Intronic
961805117 3:129483722-129483744 CTGACAAGACCAGGGAAGCTGGG + Intronic
964159916 3:153634503-153634525 CTGATAGTTCAAGAGAAGCCAGG - Intergenic
965296495 3:166954302-166954324 CCTATAAGACAACTGAAGCTTGG - Intergenic
967139022 3:186537762-186537784 GTGAACATACAAGTGAACCTGGG - Intergenic
967184939 3:186936636-186936658 CTGATTATAAAAATAAAGCTAGG + Intronic
967936793 3:194734952-194734974 CTTATTATAGAAGTGACGCTCGG - Intergenic
968004137 3:195227922-195227944 CTGGTATCACATGTGAAGCTGGG - Intronic
969631458 4:8341054-8341076 CTCAGAATACAAGTGAGCCTTGG - Intergenic
970785586 4:19792645-19792667 CTGACACTACAACTGAAGCATGG + Intergenic
972184739 4:36514758-36514780 ATGATAATAAAAGTGGAGGTTGG - Intergenic
973175497 4:47200088-47200110 CTGAGCATAGAATTGAAGCTGGG + Intronic
973873528 4:55190872-55190894 ATGATAATACCAGTAAACCTTGG + Intergenic
973992222 4:56421042-56421064 CTGTAAATACAGATGAAGCTTGG - Intronic
977296400 4:95214309-95214331 CTGTTTATAAAAATGAAGCTAGG - Intronic
978270781 4:106887320-106887342 CTCATAATACAAGCAAAGGTAGG - Intergenic
979023576 4:115537154-115537176 TTGATAATACTAATGAAGCTTGG + Intergenic
979699382 4:123650475-123650497 TTGAGAATTCAAGTGAAACTTGG + Intergenic
979736287 4:124089964-124089986 CTGGTAATAAAATTCAAGCTTGG - Intergenic
981182651 4:141763963-141763985 CTGTAAATACACATGAAGCTGGG + Intergenic
982955575 4:161761695-161761717 ATGATGATACAACTTAAGCTGGG + Intronic
985318443 4:188682584-188682606 CTGAGAATAAAGGTGCAGCTTGG - Intergenic
985622043 5:960861-960883 CTGAGAAGACAGCTGAAGCTTGG - Intergenic
986253484 5:6082344-6082366 CAGATAATACAGGTGAAGCAAGG + Intergenic
986453203 5:7887381-7887403 CTGACAATACAAGTGTGGCAAGG - Intronic
987289216 5:16492089-16492111 CTGATATTTCATGTGAAGGTTGG - Intronic
987291704 5:16514442-16514464 CTGAAGATACAAGTGAAACAAGG - Intronic
988075217 5:26343556-26343578 CTTATAATACAATTGAGGATGGG + Intergenic
992294475 5:75313899-75313921 CTGAAAATACAAAATAAGCTGGG - Intergenic
994337703 5:98588071-98588093 CTGATAATAAAAATGAATATTGG + Intergenic
994671479 5:102766515-102766537 CTGTAAATACAGATGAAGCTTGG + Intronic
994967079 5:106687208-106687230 ATAATAATACATGTGAATCTTGG - Intergenic
997667629 5:135644596-135644618 CAGATAAGAAAACTGAAGCTCGG + Intergenic
1000449960 5:161373396-161373418 CTGATAATACCAGTGCTGTTGGG - Intronic
1000498729 5:162021015-162021037 CTGATCACACAAGTGATACTGGG - Intergenic
1001150043 5:169219393-169219415 CAGACAATAAAACTGAAGCTCGG + Intronic
1002362346 5:178682484-178682506 CTGAAAAGACAAGTGCAGCTGGG + Intergenic
1002660540 5:180788412-180788434 CTGAGAATCCAAGTGCAGCTGGG + Intergenic
1003946711 6:11082815-11082837 CTGAAAATACACCTGAAGCCTGG - Intergenic
1005661076 6:28000381-28000403 CTGATAAGAAAAGTTCAGCTAGG + Intergenic
1007383735 6:41506608-41506630 CTTAAAACTCAAGTGAAGCTTGG - Intergenic
1008908853 6:56711439-56711461 TTGATAATAAAAGGGAAGATAGG - Intronic
1011468620 6:87685564-87685586 CTGATAATACAAGTGAAGCTTGG - Intronic
1013616096 6:111844931-111844953 CTGATAAGAAAAATGAAACTTGG + Intronic
1015090716 6:129354372-129354394 CTGAAAATAAATGTGAAGGTAGG + Intronic
1016059233 6:139611513-139611535 CAGATAAGACAAATGAAGCTCGG + Intergenic
1017485904 6:154901512-154901534 CTGAGAATCCAAGTGATGCTCGG - Intronic
1019314523 7:378318-378340 CAGATAAGACAACTGAGGCTCGG - Intergenic
1020875920 7:13693565-13693587 CTGATCAGGCAACTGAAGCTTGG + Intergenic
1021481615 7:21124107-21124129 ATTATAATACAAAGGAAGCTTGG - Intergenic
1026316025 7:69228396-69228418 CTGCAAATACAGATGAAGCTTGG + Intergenic
1029505025 7:100958254-100958276 GTGATCAAAGAAGTGAAGCTGGG - Exonic
1031378671 7:121059056-121059078 GTGATGATAAAAGTGAAGCGAGG + Intronic
1032115702 7:129115383-129115405 TTGATAAGAGAAGTGAAGTTAGG + Intergenic
1033935792 7:146584271-146584293 CAGATAAGAAAACTGAAGCTCGG - Intronic
1036143333 8:6228086-6228108 CTGATAATGGCAGTGGAGCTGGG - Intergenic
1038682054 8:29677859-29677881 CTTATAAAACAAGAGAAGGTAGG + Intergenic
1039609708 8:38909834-38909856 TTTATGATACAAGTGAAACTTGG - Intronic
1042371237 8:67993201-67993223 CAGATGATACAATTGAAGCAAGG - Intronic
1044475947 8:92626773-92626795 ATGAAAAAAGAAGTGAAGCTGGG + Intergenic
1045881039 8:107041072-107041094 CTGATAATTAAAGTACAGCTTGG - Intergenic
1046639421 8:116710364-116710386 CTGAAAATACAGATCAAGCTGGG - Intronic
1047723651 8:127666012-127666034 CTGCTGATACAAGTGATGGTGGG + Intergenic
1048875924 8:138837182-138837204 CTGTTGACCCAAGTGAAGCTTGG + Intronic
1056075654 9:83036199-83036221 CTGATAAAACAAATTAAGCTTGG + Intronic
1058860283 9:109111045-109111067 ATGATAATATAAATGTAGCTAGG + Intronic
1059725947 9:117008177-117008199 CTGGTAATACAGGGAAAGCTTGG + Exonic
1060651419 9:125330168-125330190 CAGAGACAACAAGTGAAGCTTGG + Exonic
1061619833 9:131804729-131804751 CAGATAAGAAAACTGAAGCTTGG - Intergenic
1186204826 X:7190389-7190411 CTGTAAATACAGATGAAGCTTGG + Intergenic
1188137724 X:26510346-26510368 CTGATTATAGAATTGAGGCTGGG - Intergenic
1188283664 X:28301539-28301561 CTGAAAATACAAGTATGGCTTGG + Intergenic
1189816449 X:44829181-44829203 CTAAAAATACAAGAGTAGCTGGG + Intergenic
1193042570 X:77019104-77019126 CAGAAAATAAAAGTGAACCTTGG - Intergenic
1195020613 X:100823411-100823433 CTGATGAAACAAATGAAGGTGGG + Exonic
1195142685 X:101978853-101978875 TTGATTATAAAAGTGAAACTAGG - Intergenic
1196106564 X:111902750-111902772 CAGATAATAAAAGTGAAGAAAGG + Intronic
1196425505 X:115564514-115564536 CTGAAAATAAAAGGGCAGCTTGG + Intronic
1196630822 X:117937479-117937501 CTGACAAAACAAGTGTAACTGGG - Intronic
1196771867 X:119302436-119302458 CAGATAAAACAAGTGAAATTTGG - Intergenic
1196919537 X:120571561-120571583 CTGATACTACAAATTAAGTTTGG - Intronic
1201577511 Y:15477023-15477045 CTGTGAATACAGATGAAGCTTGG + Intergenic