ID: 1011476771

View in Genome Browser
Species Human (GRCh38)
Location 6:87756129-87756151
Sequence ATAACATCTGTGACTAATGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011476771_1011476781 28 Left 1011476771 6:87756129-87756151 CCCTCATTAGTCACAGATGTTAT No data
Right 1011476781 6:87756180-87756202 CACCAAATTGCTGAGAGGGAAGG No data
1011476771_1011476773 -1 Left 1011476771 6:87756129-87756151 CCCTCATTAGTCACAGATGTTAT No data
Right 1011476773 6:87756151-87756173 TCCTGCTCTGCCCCACCTAAAGG No data
1011476771_1011476780 24 Left 1011476771 6:87756129-87756151 CCCTCATTAGTCACAGATGTTAT No data
Right 1011476780 6:87756176-87756198 TTAGCACCAAATTGCTGAGAGGG No data
1011476771_1011476779 23 Left 1011476771 6:87756129-87756151 CCCTCATTAGTCACAGATGTTAT No data
Right 1011476779 6:87756175-87756197 TTTAGCACCAAATTGCTGAGAGG No data
1011476771_1011476782 29 Left 1011476771 6:87756129-87756151 CCCTCATTAGTCACAGATGTTAT No data
Right 1011476782 6:87756181-87756203 ACCAAATTGCTGAGAGGGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011476771 Original CRISPR ATAACATCTGTGACTAATGA GGG (reversed) Intergenic
No off target data available for this crispr