ID: 1011476774

View in Genome Browser
Species Human (GRCh38)
Location 6:87756152-87756174
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011476774_1011476781 5 Left 1011476774 6:87756152-87756174 CCTGCTCTGCCCCACCTAAAGGC No data
Right 1011476781 6:87756180-87756202 CACCAAATTGCTGAGAGGGAAGG No data
1011476774_1011476780 1 Left 1011476774 6:87756152-87756174 CCTGCTCTGCCCCACCTAAAGGC No data
Right 1011476780 6:87756176-87756198 TTAGCACCAAATTGCTGAGAGGG No data
1011476774_1011476785 11 Left 1011476774 6:87756152-87756174 CCTGCTCTGCCCCACCTAAAGGC No data
Right 1011476785 6:87756186-87756208 ATTGCTGAGAGGGAAGGGAAGGG No data
1011476774_1011476779 0 Left 1011476774 6:87756152-87756174 CCTGCTCTGCCCCACCTAAAGGC No data
Right 1011476779 6:87756175-87756197 TTTAGCACCAAATTGCTGAGAGG No data
1011476774_1011476784 10 Left 1011476774 6:87756152-87756174 CCTGCTCTGCCCCACCTAAAGGC No data
Right 1011476784 6:87756185-87756207 AATTGCTGAGAGGGAAGGGAAGG No data
1011476774_1011476782 6 Left 1011476774 6:87756152-87756174 CCTGCTCTGCCCCACCTAAAGGC No data
Right 1011476782 6:87756181-87756203 ACCAAATTGCTGAGAGGGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011476774 Original CRISPR GCCTTTAGGTGGGGCAGAGC AGG (reversed) Intergenic
No off target data available for this crispr