ID: 1011476780

View in Genome Browser
Species Human (GRCh38)
Location 6:87756176-87756198
Sequence TTAGCACCAAATTGCTGAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011476774_1011476780 1 Left 1011476774 6:87756152-87756174 CCTGCTCTGCCCCACCTAAAGGC No data
Right 1011476780 6:87756176-87756198 TTAGCACCAAATTGCTGAGAGGG No data
1011476771_1011476780 24 Left 1011476771 6:87756129-87756151 CCCTCATTAGTCACAGATGTTAT No data
Right 1011476780 6:87756176-87756198 TTAGCACCAAATTGCTGAGAGGG No data
1011476775_1011476780 -8 Left 1011476775 6:87756161-87756183 CCCCACCTAAAGGCTTTAGCACC No data
Right 1011476780 6:87756176-87756198 TTAGCACCAAATTGCTGAGAGGG No data
1011476772_1011476780 23 Left 1011476772 6:87756130-87756152 CCTCATTAGTCACAGATGTTATC No data
Right 1011476780 6:87756176-87756198 TTAGCACCAAATTGCTGAGAGGG No data
1011476777_1011476780 -10 Left 1011476777 6:87756163-87756185 CCACCTAAAGGCTTTAGCACCAA No data
Right 1011476780 6:87756176-87756198 TTAGCACCAAATTGCTGAGAGGG No data
1011476776_1011476780 -9 Left 1011476776 6:87756162-87756184 CCCACCTAAAGGCTTTAGCACCA No data
Right 1011476780 6:87756176-87756198 TTAGCACCAAATTGCTGAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011476780 Original CRISPR TTAGCACCAAATTGCTGAGA GGG Intergenic
No off target data available for this crispr