ID: 1011476787

View in Genome Browser
Species Human (GRCh38)
Location 6:87756215-87756237
Sequence ATTCCAAATGACATATTTTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011476776_1011476787 30 Left 1011476776 6:87756162-87756184 CCCACCTAAAGGCTTTAGCACCA No data
Right 1011476787 6:87756215-87756237 ATTCCAAATGACATATTTTTGGG No data
1011476778_1011476787 26 Left 1011476778 6:87756166-87756188 CCTAAAGGCTTTAGCACCAAATT No data
Right 1011476787 6:87756215-87756237 ATTCCAAATGACATATTTTTGGG No data
1011476783_1011476787 10 Left 1011476783 6:87756182-87756204 CCAAATTGCTGAGAGGGAAGGGA No data
Right 1011476787 6:87756215-87756237 ATTCCAAATGACATATTTTTGGG No data
1011476777_1011476787 29 Left 1011476777 6:87756163-87756185 CCACCTAAAGGCTTTAGCACCAA No data
Right 1011476787 6:87756215-87756237 ATTCCAAATGACATATTTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011476787 Original CRISPR ATTCCAAATGACATATTTTT GGG Intergenic
No off target data available for this crispr