ID: 1011481310

View in Genome Browser
Species Human (GRCh38)
Location 6:87796576-87796598
Sequence AATCCCCTGCTGTCACACAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011481305_1011481310 8 Left 1011481305 6:87796545-87796567 CCACAGCCTGACTCTGAGAATAA No data
Right 1011481310 6:87796576-87796598 AATCCCCTGCTGTCACACACTGG No data
1011481308_1011481310 2 Left 1011481308 6:87796551-87796573 CCTGACTCTGAGAATAACTGGGA No data
Right 1011481310 6:87796576-87796598 AATCCCCTGCTGTCACACACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011481310 Original CRISPR AATCCCCTGCTGTCACACAC TGG Intergenic
No off target data available for this crispr