ID: 1011482796

View in Genome Browser
Species Human (GRCh38)
Location 6:87811927-87811949
Sequence GGGTTTCTGAAAAACAACTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011482796_1011482809 24 Left 1011482796 6:87811927-87811949 CCTGAGTTGTTTTTCAGAAACCC No data
Right 1011482809 6:87811974-87811996 GGCATGGAGACCTCAGATAAGGG No data
1011482796_1011482797 -6 Left 1011482796 6:87811927-87811949 CCTGAGTTGTTTTTCAGAAACCC No data
Right 1011482797 6:87811944-87811966 AAACCCAGATCCCCACCCAATGG No data
1011482796_1011482804 8 Left 1011482796 6:87811927-87811949 CCTGAGTTGTTTTTCAGAAACCC No data
Right 1011482804 6:87811958-87811980 ACCCAATGGATCCACTGGCATGG No data
1011482796_1011482810 27 Left 1011482796 6:87811927-87811949 CCTGAGTTGTTTTTCAGAAACCC No data
Right 1011482810 6:87811977-87811999 ATGGAGACCTCAGATAAGGGAGG No data
1011482796_1011482800 3 Left 1011482796 6:87811927-87811949 CCTGAGTTGTTTTTCAGAAACCC No data
Right 1011482800 6:87811953-87811975 TCCCCACCCAATGGATCCACTGG No data
1011482796_1011482808 23 Left 1011482796 6:87811927-87811949 CCTGAGTTGTTTTTCAGAAACCC No data
Right 1011482808 6:87811973-87811995 TGGCATGGAGACCTCAGATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011482796 Original CRISPR GGGTTTCTGAAAAACAACTC AGG (reversed) Intergenic