ID: 1011482796

View in Genome Browser
Species Human (GRCh38)
Location 6:87811927-87811949
Sequence GGGTTTCTGAAAAACAACTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 505
Summary {0: 31, 1: 66, 2: 78, 3: 85, 4: 245}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011482796_1011482810 27 Left 1011482796 6:87811927-87811949 CCTGAGTTGTTTTTCAGAAACCC 0: 31
1: 66
2: 78
3: 85
4: 245
Right 1011482810 6:87811977-87811999 ATGGAGACCTCAGATAAGGGAGG No data
1011482796_1011482809 24 Left 1011482796 6:87811927-87811949 CCTGAGTTGTTTTTCAGAAACCC 0: 31
1: 66
2: 78
3: 85
4: 245
Right 1011482809 6:87811974-87811996 GGCATGGAGACCTCAGATAAGGG No data
1011482796_1011482804 8 Left 1011482796 6:87811927-87811949 CCTGAGTTGTTTTTCAGAAACCC 0: 31
1: 66
2: 78
3: 85
4: 245
Right 1011482804 6:87811958-87811980 ACCCAATGGATCCACTGGCATGG No data
1011482796_1011482808 23 Left 1011482796 6:87811927-87811949 CCTGAGTTGTTTTTCAGAAACCC 0: 31
1: 66
2: 78
3: 85
4: 245
Right 1011482808 6:87811973-87811995 TGGCATGGAGACCTCAGATAAGG No data
1011482796_1011482800 3 Left 1011482796 6:87811927-87811949 CCTGAGTTGTTTTTCAGAAACCC 0: 31
1: 66
2: 78
3: 85
4: 245
Right 1011482800 6:87811953-87811975 TCCCCACCCAATGGATCCACTGG No data
1011482796_1011482797 -6 Left 1011482796 6:87811927-87811949 CCTGAGTTGTTTTTCAGAAACCC 0: 31
1: 66
2: 78
3: 85
4: 245
Right 1011482797 6:87811944-87811966 AAACCCAGATCCCCACCCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011482796 Original CRISPR GGGTTTCTGAAAAACAACTC AGG (reversed) Intergenic
900035036 1:400618-400640 GGGTTTCTACAAAACAACTCAGG + Intergenic
900056654 1:636370-636392 GGGTTTCTACAAAACAACTCAGG + Intergenic
901302360 1:8209062-8209084 GGGGTTCTCAAAGACATCTCTGG + Intergenic
903404654 1:23086155-23086177 ATGTTTCTGAAAAGCAACTGAGG - Exonic
903951518 1:26998506-26998528 GGGTTCTTCAAGAACAACTCGGG + Intronic
905547007 1:38807865-38807887 GGGTCTCTGGAACACATCTCTGG + Intergenic
905977383 1:42186618-42186640 GGGCTTCAGGAAAATAACTCAGG + Intronic
906124498 1:43419374-43419396 GGGTGTATGAAAAACACCTGGGG - Intronic
907766057 1:57411612-57411634 AGGTTTTTGAAAGACATCTCTGG - Intronic
908736600 1:67283195-67283217 AGGTTTCTGAAAAACAACTTGGG + Intergenic
909883970 1:80916731-80916753 GGGAACCTGCAAAACAACTCTGG - Intergenic
911319747 1:96398811-96398833 GGCTTTCTGAGAAACTACTGAGG + Intergenic
912461706 1:109837622-109837644 AGGATTCTGATAAATAACTCTGG + Intergenic
912523598 1:110264536-110264558 GGGTTTCTGAAAAACAACTCAGG + Intronic
915863742 1:159476123-159476145 AGGTTCCTGACAAACAAGTCAGG - Intergenic
915883804 1:159701833-159701855 GGGTTTCTGAAAAACAACTCAGG - Intergenic
919585235 1:199430277-199430299 TGGTATCTGAAAAGCAACACTGG + Intergenic
920360786 1:205414722-205414744 GGGTAACTGAAAAACAATTCTGG - Intronic
920826283 1:209426754-209426776 TGGCTTCTGAAAAACAGTTCTGG + Intergenic
920882777 1:209895874-209895896 AGGTTTCTGAAAAACAACTCAGG + Intergenic
921359999 1:214322690-214322712 GGCATTCTGAACAGCAACTCTGG - Intronic
921403963 1:214758517-214758539 GGGTTTCTGATATACTACTTGGG - Intergenic
922257564 1:223906175-223906197 GGGTTTCTACAGAACAACTCAGG + Intergenic
922323668 1:224509612-224509634 GGTTTGCAGAAAAACCACTCTGG - Intronic
922338869 1:224639597-224639619 AGGTTTCTGAAAAACAACTCAGG - Intronic
922755119 1:228092145-228092167 AGCTTTTTGAAAAAGAACTCTGG + Intronic
923016586 1:230131163-230131185 AGGTTTCTAAAAAACGACTCAGG - Intronic
923026299 1:230207091-230207113 AGGTGTCTGAATAACAACCCTGG - Intronic
923064479 1:230505355-230505377 GAGTTTCTAAAAAGCAACTCAGG + Intergenic
923308777 1:232713705-232713727 GGGTTTCTCAAAAAGAACACAGG - Intergenic
923385780 1:233464016-233464038 GGTTTTCTGAAAAATAACCCTGG + Intergenic
923868437 1:237964705-237964727 AGGTTTCTGAAAAACAACTCAGG + Intergenic
924338757 1:243008955-243008977 GGATTTCTACAAAACAACTCAGG + Intergenic
924483516 1:244458142-244458164 AGGTTTCTGATTAATAACTCTGG + Intronic
924874710 1:248089683-248089705 AAGTTTCTGAAAAACAACTCAGG - Intronic
924928501 1:248706318-248706340 AGGTTTCTGAAAACTAGCTCAGG + Intergenic
1063968406 10:11364374-11364396 GGGTTTCTGTAAAACAACTCAGG - Intergenic
1064129322 10:12694804-12694826 AGGTTTCTCAAAAGCAACACTGG + Intronic
1064611702 10:17110262-17110284 TGGTATATGCAAAACAACTCAGG + Intronic
1064827732 10:19424678-19424700 GAGTTTCTGAAAACCAAATCAGG - Intronic
1065173018 10:23050826-23050848 GGGTCTCTGAAAAACAGCTCAGG - Intergenic
1065378561 10:25066494-25066516 GGGTTTCTGAAAAACAGCTCAGG - Intergenic
1065443762 10:25776401-25776423 AGGTTTCTGAAGAACAACTCAGG - Intergenic
1065455146 10:25899288-25899310 GGGTTTCTGAAAAACAACTCGGG + Intergenic
1065801295 10:29355495-29355517 GAGTTTCTGAAAAACAACACAGG - Intergenic
1066288350 10:33990498-33990520 AGGGTTCTGAAAAACAACTTAGG + Intergenic
1067294120 10:44964802-44964824 GGGTGTCTGAAAGACAGCTGTGG - Intronic
1067399410 10:45957255-45957277 GAGTTTCTGAAAAATAACTCAGG - Intergenic
1067822279 10:49540599-49540621 GGGGTTCAGGAAAACAACTCAGG + Intergenic
1067867728 10:49926471-49926493 GAGTTTCTGAAAAATAACTCAGG - Intronic
1068000982 10:51333962-51333984 GTGTGTTTGAAAAATAACTCTGG - Intronic
1068066586 10:52139681-52139703 GTGTTTCTGATAAGCAACTTGGG + Intronic
1069219744 10:65868584-65868606 AGGTTTCCGAAAAACAATTCAGG + Intergenic
1069492597 10:68874211-68874233 AAGTTTCTGAAAGACAACTCAGG - Intronic
1070573176 10:77656978-77657000 GGGTTTCTGAAGAACCACTCAGG + Intergenic
1070821006 10:79354354-79354376 TGGCTTTTGAAACACAACTCAGG + Exonic
1072015373 10:91341578-91341600 AGGTTTCTGAAAAATAACTCGGG - Intergenic
1072352286 10:94568594-94568616 GAGTTTCAGAAAAACCAATCTGG - Intronic
1074249699 10:111732281-111732303 GGGATTCTGAAAAACAACCTTGG + Intergenic
1074385509 10:113013785-113013807 ATCTTTCTGAAAAACAAGTCAGG + Intronic
1074898741 10:117798729-117798751 GGGATTTTGAGAAACATCTCTGG + Intergenic
1074959313 10:118425947-118425969 GGGTTGCTGAAGAGCAACTCGGG + Intergenic
1074981903 10:118626691-118626713 AGGTTTCTGAGAAACAACTTGGG + Intergenic
1076430802 10:130400686-130400708 GGGTTTCTGAAAAACAACTCAGG + Intergenic
1077962139 11:7086977-7086999 GGGTTTCTGAAAGACAACTCAGG - Intergenic
1078034954 11:7794057-7794079 AGGTTTCTGAAAAACAACCCAGG - Intergenic
1078207905 11:9246253-9246275 GAATTTCTGAAAGACAGCTCAGG - Intronic
1080071811 11:28098342-28098364 GGGCTTGTGAAAATCAAATCTGG - Intronic
1080352705 11:31403720-31403742 AGGTTTCTGAAAAACAACTCAGG + Intronic
1081500784 11:43664500-43664522 GTGTTTCTGAAAAATAACACAGG + Intronic
1081518891 11:43862319-43862341 TGATTTCTGAAAAACAACAATGG - Intergenic
1083705291 11:64509964-64509986 GGGCTTCTGAAAAACAACTCAGG + Intergenic
1084316415 11:68348318-68348340 CTTTTTCTGAAAAACAACTTGGG - Intronic
1085174018 11:74471096-74471118 GTGTTACTGAAAAACAAGGCAGG - Intergenic
1086798267 11:91136485-91136507 GGGTTTGTGAAAAACAATTAGGG - Intergenic
1087179976 11:95132084-95132106 GGGTTTATGAACCCCAACTCTGG + Exonic
1088424208 11:109684189-109684211 GGGTTTATTAAAAACAAGTTTGG - Intergenic
1088713642 11:112529790-112529812 GGATTTCTACAAGACAACTCTGG - Intergenic
1088786681 11:113188689-113188711 GGGTTCCTTAAAAAGAACCCAGG - Intronic
1089327007 11:117664165-117664187 GCGTTTCAGACAAACAGCTCAGG + Intronic
1089577777 11:119458975-119458997 AGGTGTTTGAAAAACAACTCAGG + Intergenic
1089656952 11:119955040-119955062 GGTTTTCTTAAAAACAACATAGG - Intergenic
1090101185 11:123798317-123798339 GGGTTTCTGAAAAACAAGTCAGG + Intergenic
1090677317 11:129011669-129011691 GGGTTTCTGATAAACATATTTGG - Intronic
1091010575 11:131997207-131997229 GAGTTTCTGCAAAGCCACTCTGG - Intronic
1091237178 11:134030109-134030131 GGAATTCTGAGAAAGAACTCAGG - Intergenic
1091350952 11:134893603-134893625 AGGTCTCTGAAAAACACCTTAGG - Intergenic
1093379916 12:18479792-18479814 AGCTTTCTGGACAACAACTCAGG - Intronic
1093644627 12:21570856-21570878 GTGTTTAAGAAAAATAACTCTGG + Intronic
1093911765 12:24756050-24756072 GGTTTTTATAAAAACAACTCAGG + Intergenic
1093920541 12:24855184-24855206 CAGGTTCTGAAAAACAACTCTGG - Intronic
1096576334 12:52555145-52555167 GGGTTTCTGACAAACAACTCTGG - Intergenic
1097481813 12:60136697-60136719 GGGTTTCTGAAACACTACTATGG + Intergenic
1097994141 12:65869322-65869344 GGGTTCCTGAAATACAACCATGG - Intronic
1101375287 12:104166072-104166094 GGATTTCTAAAGAACAACTCAGG + Intergenic
1101508388 12:105369871-105369893 GGGTTTCTGCCCAACAACTAAGG - Intronic
1101698710 12:107151629-107151651 GGGTTTCTGGAAAACAACTCAGG + Intergenic
1102445215 12:112997014-112997036 GAGTTTCTGAAAATCAACTCAGG + Intronic
1102864234 12:116361360-116361382 GGGTTTGTAACCAACAACTCTGG + Intergenic
1103298209 12:119906391-119906413 GGGTTTTTGAAAAACAACTTAGG - Intergenic
1104706430 12:130951024-130951046 CAGGTTCTGAAAAACAACTCCGG - Intergenic
1106557002 13:30818445-30818467 GGGTTCCTGGAAAATGACTCTGG - Intergenic
1107038392 13:35923649-35923671 GGTATTCTGAAATACAACTCAGG - Intronic
1108364744 13:49698640-49698662 AGGTGTCTGAAGAACAACTCAGG - Intergenic
1108992927 13:56686132-56686154 GGGTTTATAAAAAAGAAGTCAGG - Intergenic
1109803532 13:67406503-67406525 AGGTTTCTGAAAAACAACTCAGG - Intergenic
1110139066 13:72105105-72105127 GGGTTTTAGAAAAATGACTCTGG - Intergenic
1110144106 13:72168459-72168481 GGGTTTCTGAAAAACAACTCAGG - Intergenic
1110271781 13:73599443-73599465 GTGTTTCTGAAAGACACCTTGGG - Intergenic
1112044201 13:95579296-95579318 GGATTTCTGAAAAAAGACACAGG + Exonic
1112205741 13:97321760-97321782 GAGTTTCTTAAAAGCAGCTCTGG + Intronic
1112287633 13:98118190-98118212 AGGGTTCTGAAAAACAACTCAGG + Intergenic
1113943646 13:114032133-114032155 CGGTTTTTGAAAAACAATTTAGG - Intronic
1114440131 14:22739531-22739553 GGGTTTCTGAAAAACAACTCAGG + Intergenic
1115908433 14:38227817-38227839 AGGCTTCTGAAAAACGACTAGGG - Intergenic
1115975539 14:38992627-38992649 AGGTTTCTGAAAAACAACTCAGG - Intergenic
1116414413 14:44663257-44663279 TGAGTTTTGAAAAACAACTCCGG - Intergenic
1116950627 14:50875398-50875420 AGGTTTCTGCAAACCAACTTTGG - Intronic
1117321407 14:54627324-54627346 GCGTCTTTGAAAAACTACTCTGG - Intronic
1117450147 14:55842007-55842029 GGATTTCTGAAATATAACTTTGG + Intergenic
1117571106 14:57050041-57050063 TGGTATCTGAGAAACCACTCAGG - Intergenic
1118297199 14:64581418-64581440 GAGTTTCTGAAAAACAACGCAGG + Intronic
1118460769 14:65985083-65985105 GGGTTTTTGAAGAACAACTCAGG - Intronic
1118835393 14:69474283-69474305 GGGTTTCTGGAAAGCAACTCAGG - Intergenic
1118988762 14:70779277-70779299 GAGTTTCAGCAAAACAACTATGG + Intronic
1120142717 14:80946513-80946535 GTGTTTCTGATAAACTGCTCAGG - Intronic
1120471600 14:84932823-84932845 GGGTTTCTGAAAAACAACTCAGG - Intergenic
1121172223 14:91864110-91864132 GGGTTTCTGAAAAACAACTCAGG + Intronic
1121421749 14:93820789-93820811 TAGTTTCTGAAAAACTGCTCTGG - Intergenic
1121425318 14:93846543-93846565 GGGTTTCTGAAAAACAACTCAGG + Intergenic
1123832441 15:24154640-24154662 AGGTTTATGAAAAATGACTCAGG - Intergenic
1123834251 15:24171841-24171863 AGCTTTCTGAACAACAACTCAGG - Intergenic
1123840979 15:24246875-24246897 AGCTTTCTGAACAACAACTCAGG - Intergenic
1123847452 15:24316933-24316955 AGGTTTATGAAAAATGACTCAGG + Intergenic
1123853941 15:24387387-24387409 AGCTTTCTGAACAACAACTCAGG - Intergenic
1123869903 15:24560026-24560048 AGCTTTCTGAACAACAACTCAGG - Intergenic
1123873427 15:24598987-24599009 AGGTTTATGAAAAATGACTCAGG + Intergenic
1124074838 15:26434568-26434590 GGGTTTCTGAAAAAGAACTCAGG + Intergenic
1124079486 15:26478346-26478368 AGATTTCTGAAAACCAACTGTGG + Intergenic
1124860065 15:33430631-33430653 GGGTTTCTGAAAAACAATGCGGG + Intronic
1125349872 15:38755458-38755480 GGGTTTCTGAACAACAACTTGGG - Intergenic
1126504710 15:49391457-49391479 GGGTTTCTGAAAAACAACTCAGG - Intronic
1126568633 15:50126828-50126850 AGGTTTCTGCAAAACAGCTCAGG - Intronic
1126686135 15:51250546-51250568 GTGTTTCAGAAAAACTTCTCTGG - Intronic
1127923653 15:63516643-63516665 AGGTTTCTCAACAGCAACTCTGG - Intronic
1128351116 15:66890014-66890036 GGGTTTCTGATAAATAACTCTGG - Intergenic
1129057659 15:72832990-72833012 GGATTTATGAAAGACAGCTCAGG - Intergenic
1129092574 15:73166850-73166872 AGGTTTCTGAAAAACAACCCAGG + Intronic
1129926390 15:79368057-79368079 AGGTTTCTGAAAAACAACTCAGG + Intronic
1130002670 15:80060271-80060293 TGGTTTCTGAAAAACGCCGCAGG - Intronic
1130771727 15:86930947-86930969 GGGTTTCTGAAAAACAACTAAGG - Intronic
1132250215 15:100330372-100330394 GGGTTTCTGATTCACAGCTCTGG + Intronic
1135672799 16:24389619-24389641 AGATTTCTGAAAAATAAGTCAGG - Intergenic
1135675936 16:24414918-24414940 GGGTTTTTGAAAAACAATCCAGG + Intergenic
1136607642 16:31347277-31347299 AGGTTTCTGAAAAACAACTCAGG - Intergenic
1137373129 16:47927373-47927395 TGGTTTCTGAAAAACAACTCAGG - Intergenic
1137845498 16:51684076-51684098 GGGTTTCTGACAAACAACTCAGG - Intergenic
1138340038 16:56283036-56283058 AGGTTTCTGAAAAACAACTCAGG + Intronic
1138647688 16:58437139-58437161 GGGCTTCTGAAAGACAAATGAGG - Intergenic
1139375706 16:66495201-66495223 GGCTTTCTGAGACACAAATCAGG + Intronic
1142759124 17:2033194-2033216 TGGTTTCTGAAAAACAACTTAGG + Intronic
1143219098 17:5246657-5246679 GGATTTCTGAAAAACAACTCAGG - Intergenic
1144061739 17:11589061-11589083 TGGGTTTTGAAAAACAACTCAGG - Intergenic
1144374747 17:14627929-14627951 ACGTTCCTGAAAAACAACTTAGG + Intergenic
1144413095 17:15020388-15020410 AGGTTTCTAGAAAACAACTCAGG + Intergenic
1144607324 17:16678459-16678481 GGGTTTCTGAAAAACAACTCAGG - Intergenic
1145257429 17:21334330-21334352 GTGGTGCTGAAAAACAACTCAGG - Intergenic
1145319213 17:21753705-21753727 GTGGTGCTGAAAAACAACTCAGG + Intergenic
1145822297 17:27848313-27848335 GGGTTTCTGAAAAACAACTCAGG - Intronic
1145825110 17:27871046-27871068 AGGTTTCTGCCAAACAACACAGG - Intronic
1146583494 17:34060394-34060416 GGGAATCAGAAAATCAACTCTGG + Intronic
1147236548 17:39061866-39061888 GGGCTTCTGAAAAACAACTCAGG - Intergenic
1148694263 17:49549606-49549628 GGGTTTCTGGAGAGCCACTCTGG + Intergenic
1149880614 17:60286735-60286757 GTGCTTCTGAATGACAACTCAGG - Intronic
1149893884 17:60414037-60414059 GGGTTTCTGAAAAACAACTCAGG + Intronic
1150635555 17:66910939-66910961 GTGTCTCGGAAAAAGAACTCAGG + Intergenic
1150708034 17:67505773-67505795 GGTGTTCTCAAAAACAACTTGGG - Intronic
1150914815 17:69425671-69425693 GGGATCATGAAAAACAACTGAGG - Intronic
1151315406 17:73318900-73318922 GGGCTTCTGATAAAGGACTCAGG + Intergenic
1152679255 17:81657204-81657226 CTGTTTCTGGAAAACAACTGAGG - Intronic
1153109926 18:1573947-1573969 AGGTGTTTGAAAAACAACTCAGG - Intergenic
1153585361 18:6615130-6615152 GGGCTTCTGAATACCAAGTCTGG + Intergenic
1153715825 18:7847149-7847171 TAGTTTCTGAAATACAAATCTGG + Intronic
1153907271 18:9673307-9673329 AGGTTTCTGAAGAACAAGTGTGG - Intergenic
1155342386 18:24825959-24825981 GGGTTTCCGAGAGACAACTCAGG - Intergenic
1155495253 18:26436323-26436345 GTGTTTCTTAAAAGCAAATCTGG + Intergenic
1155598612 18:27517066-27517088 AAGTTTTTGGAAAACAACTCAGG - Intergenic
1155962854 18:32009444-32009466 ATGTTCCTGAAAAACAACTTAGG - Intergenic
1156115575 18:33783594-33783616 GTCTTTCTGAGAAACAGCTCAGG + Intergenic
1156300003 18:35828023-35828045 AAGTTCCTGAAAAACAACTTAGG - Intergenic
1158236310 18:55319588-55319610 GCGTTTATTAAAAACAAATCTGG - Intronic
1158239122 18:55357180-55357202 TGGTTTCTGAAAATCCATTCTGG + Intronic
1158398207 18:57096285-57096307 GTCTTCCTGTAAAACAACTCAGG - Intergenic
1158930769 18:62324039-62324061 GGGTTTCTGAGAAACAATTCAGG - Intergenic
1159075554 18:63677751-63677773 GGCCTTCAGAAAAAAAACTCAGG - Intronic
1159820031 18:73129733-73129755 GTGTTTCTGAGAAACATCCCTGG - Intergenic
1161382871 19:3975652-3975674 GGGTTTCTAATAAACTAGTCAGG + Intergenic
1162253697 19:9469603-9469625 GTGTTTGTGAAGAACAACCCTGG - Intronic
1162260864 19:9532818-9532840 GTGTTCATGAAGAACAACTCTGG - Intronic
1164436391 19:28233661-28233683 GAGTTTTTGAAACACAACTCAGG + Intergenic
1165080933 19:33305615-33305637 GGGTTCCTGAGAATCTACTCTGG + Intergenic
926374250 2:12210737-12210759 CAGTTTCTGAAAAAAAACTCAGG - Intergenic
927231176 2:20825532-20825554 GGGTTTCTGAAAAACAACTTGGG + Intergenic
927927107 2:27021538-27021560 GGCTTTCTAAAACACAAATCTGG + Intronic
929502501 2:42502394-42502416 GGGTTTCTGAAAAACAACTCAGG + Intronic
931386770 2:61804902-61804924 ATGTTTCTGAAAAACAACTCAGG - Intergenic
933155163 2:78965096-78965118 GGGTTTCTGAAAAACAACTTAGG + Intergenic
933262066 2:80141914-80141936 GGATTTCTGAAAAACAACTCAGG - Intronic
933782119 2:85810154-85810176 GGGTTTCTGATAAAAAGCTGTGG - Intergenic
934893177 2:98088216-98088238 TAGTTTCTGAAAAAGAAGTCTGG - Intronic
935122313 2:100193625-100193647 GGGTTTCTGAGGAACAACTCAGG + Intergenic
936615270 2:114041830-114041852 GGGTTTTTGAAAATTAACTTAGG + Intergenic
936651503 2:114432456-114432478 GGGTTTCTCAATAGCAATTCTGG - Intergenic
936997108 2:118426983-118427005 TGGTTTCTTAAAACCAATTCTGG - Intergenic
937806964 2:126157872-126157894 GAGTTTCTGAAAAACAACTTAGG - Intergenic
937892565 2:126949895-126949917 GCATTTCTGGAAAACAACTAAGG - Intergenic
938256693 2:129864825-129864847 AGATTTCTGAAAAACAACTCTGG + Intergenic
938256987 2:129866971-129866993 GGGTTTCTGAAAAACAACTCAGG + Intergenic
939245665 2:139620677-139620699 AGGAATCAGAAAAACAACTCTGG - Intergenic
939387951 2:141525805-141525827 GGATTTCTGATAAACAACTCAGG + Intronic
939885214 2:147673952-147673974 GTGTTTCTCAAAATGAACTCAGG + Intergenic
939957978 2:148542537-148542559 GGGTGTCTAAACAACCACTCGGG + Intergenic
940173341 2:150851801-150851823 AGCTTTATGAGAAACAACTCAGG + Intergenic
940175424 2:150872526-150872548 GCATTTCTGAAAAACAGCTCAGG + Intergenic
940287497 2:152047213-152047235 GGGTTTCTGAAAAACGACTCAGG - Intronic
940878085 2:158918600-158918622 AAGTTCCTGAAAAACAACTTAGG - Intergenic
942221847 2:173776414-173776436 AGCCTTTTGAAAAACAACTCTGG - Intergenic
944169635 2:196760503-196760525 GGTTTTTTGAAAAACAACTTAGG - Intronic
947897555 2:233689749-233689771 AGGTTTCTGAAAAACAACTCGGG + Intronic
1168802398 20:652058-652080 GGTATCCTGAAAAACATCTCGGG + Intronic
1170191902 20:13652731-13652753 GGATTTCTGAAAAACAATTCAGG + Intergenic
1170467921 20:16639644-16639666 GGGTTTCTGAAAAACACCTTGGG + Intergenic
1170725085 20:18919065-18919087 AGATTTCTGAAAAACAACTCAGG + Intergenic
1170903731 20:20491596-20491618 ACTTTTCTGAAGAACAACTCTGG + Intronic
1171342902 20:24444570-24444592 GGTTTTCTGAAAAACAACTCAGG + Intergenic
1174537304 20:51261210-51261232 GGGTTTCTGAAAAATAATTCAGG + Intergenic
1174944998 20:54975133-54975155 AAGCTTCTGAAAAACAACTCTGG + Intergenic
1175235149 20:57504604-57504626 AGGTTTCTAAAAAACAACTCAGG - Intronic
1175753389 20:61514383-61514405 AGGTTTCTGAAAAACAGTTCAGG + Intronic
1175867304 20:62186128-62186150 AGGTTGGGGAAAAACAACTCGGG - Intronic
1177007591 21:15692899-15692921 CAGTTTCTGAAAGACAACTCAGG + Intergenic
1177416028 21:20794507-20794529 AAGTTTCTGAAAGACAAGTCAGG - Intergenic
1180310260 22:11218804-11218826 GGATTTCTGAAAAACTTCTTTGG + Intergenic
1181340577 22:22176436-22176458 GAGTGTTTGAAAAACAACTCAGG - Intergenic
1181563732 22:23721071-23721093 GCGCTTCTGAAAAACAACTTAGG + Intergenic
1181984068 22:26787132-26787154 AGGGTTCTGGAAAACAACTCAGG + Intergenic
1182173897 22:28263062-28263084 GGCTTTCTTAAAAACCACTTTGG - Intronic
1185200997 22:49504802-49504824 AGGTTTCTGAAAAACTAGTAGGG - Intronic
1185300847 22:50080014-50080036 GGGAATCTGAAAAACAAGGCAGG + Exonic
949118754 3:360121-360143 GGTTTTCTGAACATCAACTATGG - Intronic
949124472 3:429926-429948 GGGGTTCTGAAACAAATCTCTGG + Intergenic
949339886 3:3017996-3018018 TTGTTTCTGAAAAGTAACTCAGG + Intronic
949823463 3:8139782-8139804 AGGTTTCTGAAAAACAACTCTGG + Intergenic
949922515 3:9014073-9014095 GGGTTTCTCACAACCAAGTCCGG - Intronic
950321569 3:12059582-12059604 GGGTTTCTGAAAAACAACTCAGG + Intronic
950920500 3:16689395-16689417 AGGAGTCTGAAAAACAACGCAGG - Intergenic
950945244 3:16939066-16939088 GGCTTCCTGAAAATCAACTAAGG + Intronic
951000871 3:17558059-17558081 GGGTTCTTGAAAAAGTACTCTGG - Intronic
951274837 3:20672544-20672566 GGGTTTCTGAAAAGCAACTCAGG - Intergenic
951587940 3:24234482-24234504 GAGTTTCTAAAAAACAAGCCTGG + Intronic
952041428 3:29266501-29266523 GCATCTCTGAAAACCAACTCTGG + Intergenic
952162245 3:30705683-30705705 GGATTTCTGTAAACCAACTCAGG - Intergenic
952291692 3:32022990-32023012 GGGTTTCTGAAAAACAACTCAGG + Intronic
952300838 3:32103474-32103496 GGGTTTTTAAAAAACAACTCAGG - Intergenic
952801213 3:37293810-37293832 AGGTTTCTGAAAGAACACTCTGG - Intronic
952908601 3:38163898-38163920 GGGTTTCTAAAAAACAACTCAGG + Intergenic
953694810 3:45149168-45149190 GGATTTCTCAAGAACAACACTGG - Intergenic
953695034 3:45151246-45151268 GGATTTCTCAAGAACAACACTGG + Intergenic
955130807 3:56166071-56166093 GAGTTTCTGAAAAACATTTTTGG + Intronic
955489872 3:59471315-59471337 AGGCTTCTGAAAATCAACTTGGG + Intergenic
955664764 3:61338471-61338493 GGGTTTCTGAAAAACAACTCAGG + Intergenic
955848339 3:63192670-63192692 GGGTTTTTTAAAGACAGCTCAGG + Intergenic
956021921 3:64942113-64942135 GGGTTTTAGAAAGACTACTCTGG - Intergenic
956130355 3:66047423-66047445 GGGGTTTTGAAAAATGACTCGGG + Intergenic
956907355 3:73780608-73780630 GGGTTTGTCAAAAACAATTCTGG + Intergenic
956950364 3:74274703-74274725 AGGAATCAGAAAAACAACTCTGG + Intronic
958514150 3:95091001-95091023 TAGTTTCTGAAAAACTACTCAGG + Intergenic
959477109 3:106824412-106824434 AGGTTTATGAAAAACAACTCAGG - Intergenic
959582834 3:107999731-107999753 GGCTTTCTGAAAAACAACTCGGG + Intergenic
959634952 3:108555492-108555514 GGGTCTCTGAAATACAACTCAGG - Intronic
960475120 3:118114893-118114915 GGATTTCTCAACAGCAACTCTGG - Intergenic
960740776 3:120831052-120831074 AGGTCTCTAAAAAACAACTCAGG + Intergenic
962094975 3:132284272-132284294 GTGTTTCTGAAAAGTAGCTCAGG + Intronic
962551745 3:136500095-136500117 TGTTTTCTGGAAAACAACTTTGG - Intronic
963198968 3:142567394-142567416 GGGTTGCTGAAAAATAACAAAGG - Intronic
963273143 3:143304960-143304982 GGGTCTATGAATAATAACTCTGG + Intronic
964448986 3:156791750-156791772 AAGTTTCTGAAAAATAACTCAGG - Intergenic
965148023 3:164931695-164931717 GGGATTCTGAAAATAAACTGAGG - Intergenic
965336957 3:167438085-167438107 AGGTCTCTGAAAAACAACTCAGG - Intergenic
965896532 3:173584491-173584513 GGGTGACTGAAAAAAAACTCTGG - Intronic
966286330 3:178300305-178300327 GGTTTTCTGAAAAGCAGCTTTGG - Intergenic
966674258 3:182568323-182568345 GGGTTTCTGAAACACAGCTCAGG - Intergenic
966962432 3:184953619-184953641 AGGTTTCAGAAAAACAACTCAGG + Intronic
967362035 3:188642158-188642180 GGTTTTCTGAAATAAACCTCAGG - Intronic
967898968 3:194427440-194427462 GGCTTTTTGAAAAACGCCTCAGG + Intronic
969215249 4:5716589-5716611 AGGTTTCTGAAAAACAACTCAGG + Intronic
970225107 4:13849653-13849675 AGGTTTTTAAAAAACAACTCAGG - Intergenic
972401133 4:38704857-38704879 GGGTTTCTGAAAAGCAACTGAGG + Intergenic
972546531 4:40085334-40085356 GTGTATCTAAAAAACATCTCAGG - Intronic
973016334 4:45143032-45143054 GTGTTTCTCAAAAATAATTCTGG - Intergenic
975712023 4:77170467-77170489 AGGTTTCTGGAAAACAACTCAGG - Intronic
976284292 4:83356120-83356142 AGGTTTCTGAAAAACAACTCAGG + Intergenic
976301298 4:83517965-83517987 GAGTTTATAAACAACAACTCTGG - Intronic
977386579 4:96347757-96347779 TGGTTTCTGTAAAACAACTTGGG + Intergenic
978475767 4:109128190-109128212 GGGTTTCTGAAAAACAACTCAGG - Intronic
978588112 4:110294530-110294552 TGGTTCCTGAAAGACAAGTCAGG + Intergenic
978627098 4:110699153-110699175 AAGTTTCTGAAAAAGAAATCAGG - Intergenic
979238358 4:118426284-118426306 GGGTTTCTACAAAACAACTCAGG - Intergenic
979751042 4:124278746-124278768 GGATTTCTGAAAAAGAACTCAGG + Intergenic
980033409 4:127856412-127856434 AGGTTTCTGAAAAGTAATTCAGG + Intergenic
980395170 4:132203772-132203794 AGCCTTCTGAAAAACAACTGGGG + Intergenic
981000849 4:139827355-139827377 GGGTTTCTGAAAAGGAGCTGTGG + Intronic
981243082 4:142502132-142502154 GAGTTTCTGAAAAACAACTCGGG - Intronic
981351181 4:143731494-143731516 AGGCTTCTTAAAAACAACTCAGG - Intergenic
982131435 4:152232357-152232379 TTGTTTCTGCAAAACAACTTTGG - Intergenic
982878331 4:160675973-160675995 TGGTTTCTGAATAAGAAATCAGG + Intergenic
983810069 4:172050629-172050651 AGGTTTCAGCAAAACAATTCAGG + Intronic
985227792 4:187781251-187781273 ATGTTTCTGAAAGACAACTCAGG - Intergenic
985608619 5:873216-873238 AGGTTTCTGAAAGACAACTCAGG - Intronic
986289623 5:6389327-6389349 AGGTTTTTGAAAAATAACTCAGG - Intergenic
987018251 5:13843284-13843306 ATGTTTCTGAAACACAAATCAGG + Intronic
988663278 5:33297369-33297391 AGGTTGCTGAAAAACAACTCAGG - Intergenic
988707039 5:33736664-33736686 GGGTTTTTCAATAACAAGTCTGG + Intronic
988920811 5:35940462-35940484 AGGTTTCAGAAAATCAAATCTGG + Intergenic
989477384 5:41890081-41890103 AGGTTTCTGAAAAACAATTCAGG + Intergenic
989839075 5:46037385-46037407 TGGTTTCTGAGAAACCACTTTGG + Intergenic
991083636 5:62627662-62627684 TGGTTGCAGAAAAACATCTCAGG - Exonic
991582615 5:68172648-68172670 AGGTATCTGAAATCCAACTCTGG - Intergenic
992084223 5:73263624-73263646 GGGTTTATGAAACAGAATTCTGG + Intergenic
992909952 5:81386584-81386606 GTGTTTCTCAAAATCAAATCTGG - Intronic
993047986 5:82890134-82890156 GTGTATCTGAAAAACAAGTGAGG - Intergenic
993760524 5:91791054-91791076 GGCTTTCTTAAAAAAAAATCAGG - Intergenic
994188717 5:96843665-96843687 GAGTTTCTGAAAAACAACTCAGG - Intronic
994288607 5:98000350-98000372 AGGTTTCTGAAAGACAAATGGGG - Intergenic
995599649 5:113781415-113781437 AGATTTCTGAAAAATAACTCAGG + Intergenic
995941304 5:117588196-117588218 GTCTTTATGAAAAACAACTGAGG + Intergenic
996891577 5:128427394-128427416 GGGTTTCTGAAAAACAACTCAGG - Intronic
997537710 5:134635511-134635533 GGGTTTCTGAAAAACAACTCAGG - Intronic
999289811 5:150416969-150416991 GGGTTTATGAAAAGCAATGCAGG - Intergenic
999582921 5:153059696-153059718 GGGTTTCTAAAGAACAACTCAGG - Intergenic
1000026344 5:157362348-157362370 AGGTTTCTGAAAAAGAACTCTGG + Intronic
1000229362 5:159300481-159300503 GCGTTTCTGAAAAATAACTCAGG - Intergenic
1001292096 5:170470956-170470978 GGGTTTCTGAAACACAACTCAGG + Intronic
1001918507 5:175581940-175581962 AGGTTTCTGAAAAACAACTCAGG - Intergenic
1002738783 5:181418253-181418275 GGGTTTCTACAAAACAACTCAGG - Intergenic
1004225294 6:13779296-13779318 GGGTTTCTGAAAAACAACCGAGG + Intergenic
1004475138 6:15964521-15964543 AAGTTTCTGAAAAGCAACTCTGG + Intergenic
1005718540 6:28577614-28577636 GGGTTTCTGAAAAACAACTTAGG - Intronic
1006040798 6:31252976-31252998 GAGTTTCTGAAAAACAACTCAGG + Intergenic
1006051141 6:31345380-31345402 ATGTTTCTGAAAAACAACTCAGG + Intronic
1006416750 6:33908912-33908934 AGGTTTCTGGAAGACAACCCGGG + Intergenic
1006732282 6:36245291-36245313 GGGTTTCTGAAAAACAACTCAGG + Intronic
1007215032 6:40230300-40230322 AGGTTTCTGGAAAACAGCTCAGG + Intergenic
1007221190 6:40280257-40280279 AGGTTTCTGAAGAACAACTCAGG - Intergenic
1007467162 6:42061409-42061431 AGGTTTCTGATTAATAACTCTGG - Intronic
1008738626 6:54577537-54577559 GGGTTTCTGAAGAACACGTTGGG + Intergenic
1008776091 6:55039540-55039562 GGTTTTTTGAAAAACAGCTCAGG + Intergenic
1008930411 6:56933014-56933036 GGGTTTCTGAAAAACAACTCAGG - Intronic
1009259394 6:61464973-61464995 AGCTTTCTGAGAAACTACTCGGG + Intergenic
1009496484 6:64355022-64355044 ATGTTTCTTTAAAACAACTCAGG + Intronic
1009778142 6:68232956-68232978 GGGTTTCAGAAACACACCCCCGG - Intergenic
1009883919 6:69602186-69602208 AGGTTTCTGAAAAACAACTTAGG + Intergenic
1010311778 6:74395221-74395243 GTATCTCTGAAAAAAAACTCAGG - Intergenic
1010341329 6:74756091-74756113 GGGTTTCTGGAAAAATTCTCTGG + Intergenic
1010819224 6:80394045-80394067 GGATTTCTCAAAAATAACACTGG - Intergenic
1011482796 6:87811927-87811949 GGGTTTCTGAAAAACAACTCAGG - Intergenic
1011488425 6:87867051-87867073 GAGTTTTTGAAAGACAACTCAGG + Intergenic
1012317838 6:97801773-97801795 GGGTTTCAGAACAATCACTCTGG - Intergenic
1014028077 6:116671771-116671793 GGGTTTCTGGAAAACAACCCAGG + Intergenic
1014249215 6:119098799-119098821 GAGTTTCTGAAAAACAACTCAGG + Intronic
1015413724 6:132924252-132924274 GAGTTTCTGAAAAACAAGCATGG - Intergenic
1015550680 6:134409478-134409500 TGGTTTCCGATAAACAAATCAGG - Intergenic
1016108439 6:140191058-140191080 AGGTTCCTGAAAAAAAAATCTGG - Intergenic
1016680894 6:146828370-146828392 GGTTTTCTGAAAGACAACTATGG - Intergenic
1016741838 6:147536897-147536919 GGGTTTCTGATAAATAACTTTGG - Intronic
1016906774 6:149158694-149158716 AGGATTCTGAAAAACAACTAAGG + Intergenic
1017831062 6:158129174-158129196 TTGCTTCAGAAAAACAACTCAGG + Intronic
1018012187 6:159681354-159681376 GGGTTTCTGAAAAGTAGCTCAGG - Exonic
1018656304 6:166040555-166040577 GGGTTTCTGAAAGACAACTCAGG - Intergenic
1019140481 6:169939319-169939341 GGGTTTCTGAAAAGCGACTCGGG + Intergenic
1019243889 6:170693805-170693827 GGGTTTCTACAGAACAACTCAGG - Intergenic
1019910156 7:4095408-4095430 GGGTTTCTGAAAAACAACTCAGG + Intronic
1020075003 7:5252118-5252140 AGGTTTCTGAAAAACAACTCAGG - Intergenic
1020151395 7:5684557-5684579 GGGTTGCTGGAAATCAAGTCTGG + Intronic
1020592373 7:10157070-10157092 AGGTTTCTGAGAAACCATTCAGG - Intergenic
1021822119 7:24508580-24508602 GGGTTTCTAAAGAACAACTCAGG + Intergenic
1023110712 7:36808093-36808115 GGGTTTCTGAAAAACAACCCAGG + Intergenic
1023485499 7:40681950-40681972 GGGTTTCTGAAAAACAAGTCAGG + Intronic
1023498794 7:40826689-40826711 GGGTGACTCAAAAACAACCCTGG - Intronic
1024052932 7:45640682-45640704 AGGTTTCTAAAAAACAACTCAGG + Intronic
1024136587 7:46415045-46415067 GGGTTTCTGAAAAACAACTCAGG - Intergenic
1024286872 7:47765464-47765486 AGGTTTTTTGAAAACAACTCAGG + Intronic
1024321712 7:48077719-48077741 GGGTTCCTGAAAAACAACTCAGG - Intergenic
1025101908 7:56142620-56142642 GGGTTTCTGAAAAGCAACTTGGG + Intergenic
1025156279 7:56609064-56609086 GGGTTTTTTAAAAAAAAATCAGG - Intergenic
1025204064 7:56981423-56981445 AGGTTTCTGAAAAACAACTCAGG + Intergenic
1025640490 7:63362740-63362762 GAATTAATGAAAAACAACTCAGG + Intergenic
1025642209 7:63385353-63385375 GAATTAATGAAAAACAACTCAGG - Intergenic
1025667876 7:63595511-63595533 AGGTTTCTGAAAAACAACTCAGG - Intergenic
1026209893 7:68294791-68294813 AGGTTTTTAAAAAACAACTCAGG + Intergenic
1026212966 7:68323212-68323234 GGATTTCTGAAAAACAATTCAGG + Intergenic
1026264295 7:68783068-68783090 ACGTTTCTGAAAAACAACTCAGG - Intergenic
1026266465 7:68799804-68799826 AGGATTCTGAAAACCAACTCAGG + Intergenic
1026317368 7:69238884-69238906 GGGTTTCTGAAAAGCAACTCGGG - Intergenic
1026346799 7:69481560-69481582 GGGTTTCTGAAAAACAACTCAGG - Intergenic
1027479135 7:78672614-78672636 GTGTTTCCTAAAAACAACTGTGG - Intronic
1027929184 7:84509118-84509140 GGGTTTCTGAAATAAAATTTAGG - Intergenic
1028077965 7:86537909-86537931 GGGTTTGTAAAAAACAACTCAGG + Intergenic
1028561401 7:92179685-92179707 CGGTTCCTGAAAAATAGCTCGGG - Intergenic
1028925744 7:96355327-96355349 AGGTTTCTGAAAAACAACTCAGG + Intergenic
1029013072 7:97283045-97283067 TGGGTTCTGAAAAACAGTTCTGG - Intergenic
1029015827 7:97314674-97314696 GGGTTTCTGAAAAACAATCCAGG + Intergenic
1029150359 7:98476059-98476081 AGGTTTCTGAAACACAGCTCAGG + Intergenic
1030603324 7:111613120-111613142 AGGTTTCTGAAAAACAACTCAGG - Intergenic
1030651745 7:112123375-112123397 GGGTTTCTGAACCCCAACACGGG + Intronic
1031353909 7:120767062-120767084 AGGTTTCTGAAACACAACTCGGG - Intergenic
1031516935 7:122712334-122712356 GGGAATATGAAAAACAACTAAGG - Intronic
1034091876 7:148371183-148371205 GGGTTGCTGGAAAACAAAACTGG + Intronic
1034342366 7:150366115-150366137 AGGTTTCTGAAGAGCAACTCAGG + Intergenic
1035457172 7:159016180-159016202 GGGCTTCTGAAAGGCAGCTCGGG - Intergenic
1035504235 8:114355-114377 GGGTTTCTACAAAACAACTCAGG + Intergenic
1036136028 8:6162489-6162511 GGGTTTCTGAAAAACCACTCAGG + Intergenic
1036509557 8:9387760-9387782 TTGTTTCTAAGAAACAACTCAGG + Intergenic
1036805118 8:11826291-11826313 GGGTGACAGAAAAACAAGTCAGG + Intronic
1037039150 8:14209284-14209306 GGGCTTCTGAATAAGAATTCTGG - Intronic
1037338932 8:17821384-17821406 GCGTTTCCGAAGGACAACTCAGG - Intergenic
1037670573 8:21011944-21011966 GGGTTTCTGAAAAACAACTCAGG - Intergenic
1038478904 8:27887946-27887968 GGGTTTCTGAAAAACACCTCAGG - Intronic
1038665107 8:29531058-29531080 GGGTTTCTGAAAAATAACTCAGG - Intergenic
1038702692 8:29863806-29863828 GGTTTTTTAAAAAACAATTCAGG + Intergenic
1038704951 8:29884809-29884831 GGGTTTCCGAAAAACAATTCGGG - Intergenic
1038753898 8:30322423-30322445 TGATTTCAGAAAAACAACTCAGG + Intergenic
1038808227 8:30813592-30813614 AGGTTTCTGAAAAACAACTCAGG - Intronic
1038861608 8:31394117-31394139 GGGTTTCTGCAAAACAATTCAGG + Intergenic
1039000522 8:32974568-32974590 GGGTTTCTAAAACACAACTCAGG + Intergenic
1039367769 8:36949653-36949675 TGGTTTCTGAAAAAAAGATCTGG + Intergenic
1039573401 8:38604532-38604554 AGGTTTCTGAAAAACAGCTCAGG - Intergenic
1039743704 8:40404998-40405020 AGGCTCCTGAAAAACAACTCAGG + Intergenic
1039796268 8:40918202-40918224 CGGTTTGTGAAAAACAACCCAGG + Intergenic
1040622505 8:49105636-49105658 GGGTTTCTGAGAAACAACTCAGG + Intergenic
1040677716 8:49770638-49770660 GGATTTCTGAAAAACAACTCAGG + Intergenic
1040919176 8:52598015-52598037 TGATTTCTGAAAAACAACTCAGG - Intergenic
1040944818 8:52873587-52873609 GGGTTTCTAAAAAGCAATCCAGG + Intergenic
1041642888 8:60221537-60221559 GGGTTTGAGAAAAACAACTGTGG - Intronic
1043503203 8:80876171-80876193 GGGTTTCGGAAACATAAATCTGG - Intergenic
1043689632 8:83134122-83134144 AGAGTTCTGAAAAACAATTCAGG - Intergenic
1043777381 8:84286935-84286957 CGGTTTCTGGAAAACAACTTAGG + Intronic
1044445130 8:92266309-92266331 GGGGTGATGAAAAACAAATCAGG + Intergenic
1045049551 8:98310306-98310328 GAGTTTCTGAAAAACAACTCAGG + Intergenic
1046130230 8:109958215-109958237 GGGTTTCAGAAAAATAGTTCTGG + Intergenic
1046151923 8:110238643-110238665 GTGTTTCTAAAACACAAATCTGG + Intergenic
1047241184 8:123089993-123090015 GGGTTTCAGAAAAGGAACTATGG + Intronic
1048219831 8:132531015-132531037 GAGTTTCTGAAAAGTAACTCAGG + Intergenic
1049327779 8:142032653-142032675 AGGTTTCTGAAAAACAACTCAGG + Intergenic
1052194628 9:25696300-25696322 AAATTTCTGAAAAACAACTTAGG - Intergenic
1052273457 9:26651923-26651945 GGAGTTGTGAAAAACCACTCTGG - Intergenic
1053148709 9:35729543-35729565 GGATTTTAGAAAAATAACTCTGG + Intronic
1053179050 9:35952055-35952077 GGGTTTCTAGAAAACAACTCAGG + Intergenic
1053519377 9:38762802-38762824 AGGTTTCTGAAAAACTACTCAGG - Intergenic
1053564659 9:39236494-39236516 GGGTTGTTGGAAAACAATTCAGG - Intronic
1053649867 9:40156609-40156631 GCGTTTCTCAAAAATAATTCTGG + Intergenic
1053755880 9:41307333-41307355 GCGTTTCTCAAAAATAATTCTGG - Intergenic
1053856783 9:42346013-42346035 GGGTTTCTGAAAAACAACTCAGG + Intergenic
1054132493 9:61382540-61382562 GGGTTGTTGGAAAACAATTCAGG + Intergenic
1054330375 9:63748371-63748393 GTGTTTCTCAAAAATAATTCTGG + Intergenic
1054362804 9:64193865-64193887 AGCTTTCTGAGAAACTACTCGGG + Intergenic
1054534714 9:66219594-66219616 GCGTTTCTCAAAAATAATTCTGG - Intergenic
1054568514 9:66784751-66784773 GGGTTTCTGAAAAACAACTCAGG - Intergenic
1055254531 9:74351959-74351981 GAGTTTCTGAAAAAAAAATGTGG + Intergenic
1055651689 9:78412359-78412381 GGATCTCTGAAAGACAACTCAGG - Intergenic
1056531750 9:87494245-87494267 GGGTTTCTGAATGACTACTGTGG + Intergenic
1056637797 9:88345947-88345969 GGGTCTCTGAAAACCAGGTCTGG + Intergenic
1056729918 9:89156656-89156678 AGGTTTCTGGAAAACAACTCAGG - Intronic
1059106772 9:111518773-111518795 GAGTTTCTGAAAAACAACTCAGG + Intergenic
1059690715 9:116683187-116683209 AGGTTTCTGATTAAAAACTCTGG + Intronic
1203604077 Un_KI270748v1:43029-43051 GGGTTTCTACAAAACAACTCAGG - Intergenic
1185770663 X:2763337-2763359 GGGTTCCTGAAAATCAACTCAGG - Intronic
1185880148 X:3733443-3733465 GGGTTCCTGAAAAACAGCTCGGG - Intergenic
1186026631 X:5320459-5320481 GGGTTTCTGAAGAACAACTCAGG + Intergenic
1186055434 X:5644581-5644603 AGATTTCTGAAAAACAACTGAGG + Intergenic
1186130560 X:6461210-6461232 GGGTTTCTGAACAACAACTCAGG - Intergenic
1186177934 X:6944700-6944722 AGGCTTCTGAAAAACAACTCAGG - Intergenic
1186216655 X:7307861-7307883 CACTTTCTGAAAAACAACTATGG + Intronic
1187112370 X:16314909-16314931 AGGTTTCTGAAAAACAACTCAGG - Intergenic
1187535697 X:20140093-20140115 GAATTTCTCCAAAACAACTCTGG - Intronic
1187854509 X:23623898-23623920 AAGTTTCTGAAAGATAACTCGGG - Intergenic
1188212150 X:27439584-27439606 GGGTTCCTGAAAAACAACTCAGG + Intergenic
1188686754 X:33078971-33078993 AGGTTTCTGATTAATAACTCTGG - Intronic
1188916250 X:35914565-35914587 GAGTTTCTGAACAACAAGGCAGG - Intergenic
1189480487 X:41388823-41388845 GAGGTTCCGAAAAACAACTCAGG + Intergenic
1189893337 X:45628383-45628405 GGGTTTCTGAAAAACAACTTAGG + Intergenic
1191089461 X:56604257-56604279 GGGTTTCTGAAAAGCAATCACGG + Intergenic
1192130574 X:68545832-68545854 AGGTTTCTGAAAAACAACTCAGG + Intergenic
1193526393 X:82595255-82595277 CTGTTTTTGAAAAAAAACTCAGG + Intergenic
1195002044 X:100651264-100651286 GGGTTTAAGAAAAAGAAGTCAGG + Intronic
1195694705 X:107658419-107658441 AGGTTTAGGAGAAACAACTCAGG + Intergenic
1196677092 X:118431174-118431196 GTGCTTCAGAAAAAGAACTCTGG - Intronic
1196802213 X:119553932-119553954 GGGTTTCAGAAAAATAAGGCAGG + Intronic
1198825226 X:140691919-140691941 AGTTTTCTGAAGAACAACTCAGG + Intergenic
1198984125 X:142429656-142429678 GGGTTTCTGAAAAACAACTCAGG + Intergenic
1200283729 X:154801073-154801095 GTGTTGCTAAAAAAGAACTCTGG - Intronic
1200785561 Y:7257541-7257563 GGGTTTCTAGAAAACAACTTGGG + Intergenic
1201299609 Y:12494408-12494430 GGGTTCCTGCAAATCAACTCAGG + Intergenic
1202386138 Y:24328076-24328098 GGATTTCTACAAAACAACTCAGG - Intergenic
1202484648 Y:25342052-25342074 GGATTTCTACAAAACAACTCAGG + Intergenic