ID: 1011482800

View in Genome Browser
Species Human (GRCh38)
Location 6:87811953-87811975
Sequence TCCCCACCCAATGGATCCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011482795_1011482800 4 Left 1011482795 6:87811926-87811948 CCCTGAGTTGTTTTTCAGAAACC 0: 53
1: 69
2: 95
3: 68
4: 309
Right 1011482800 6:87811953-87811975 TCCCCACCCAATGGATCCACTGG No data
1011482796_1011482800 3 Left 1011482796 6:87811927-87811949 CCTGAGTTGTTTTTCAGAAACCC 0: 31
1: 66
2: 78
3: 85
4: 245
Right 1011482800 6:87811953-87811975 TCCCCACCCAATGGATCCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011482800 Original CRISPR TCCCCACCCAATGGATCCAC TGG Intergenic
No off target data available for this crispr