ID: 1011484542

View in Genome Browser
Species Human (GRCh38)
Location 6:87828539-87828561
Sequence AGGCAGTTAGTGAGGAAACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011484542_1011484551 25 Left 1011484542 6:87828539-87828561 CCCTGTTTCCTCACTAACTGCCT No data
Right 1011484551 6:87828587-87828609 TTCCCTTGTTCCCCAGTCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011484542 Original CRISPR AGGCAGTTAGTGAGGAAACA GGG (reversed) Intergenic
No off target data available for this crispr