ID: 1011488421

View in Genome Browser
Species Human (GRCh38)
Location 6:87867025-87867047
Sequence TTGGTGGGAGTCCCCGGTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011488410_1011488421 11 Left 1011488410 6:87866991-87867013 CCGCATATCTGAGGTCGGTGTGC No data
Right 1011488421 6:87867025-87867047 TTGGTGGGAGTCCCCGGTGGAGG No data
1011488409_1011488421 12 Left 1011488409 6:87866990-87867012 CCCGCATATCTGAGGTCGGTGTG No data
Right 1011488421 6:87867025-87867047 TTGGTGGGAGTCCCCGGTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011488421 Original CRISPR TTGGTGGGAGTCCCCGGTGG AGG Intergenic
No off target data available for this crispr