ID: 1011489307

View in Genome Browser
Species Human (GRCh38)
Location 6:87874310-87874332
Sequence TACTTTGAACTGAAGGAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011489307_1011489317 27 Left 1011489307 6:87874310-87874332 CCCACCTCCTTCAGTTCAAAGTA No data
Right 1011489317 6:87874360-87874382 GGGTATGGAATGAGTTCCAATGG No data
1011489307_1011489314 6 Left 1011489307 6:87874310-87874332 CCCACCTCCTTCAGTTCAAAGTA No data
Right 1011489314 6:87874339-87874361 AGGCTGTGGTGCTGTACTTTGGG No data
1011489307_1011489316 12 Left 1011489307 6:87874310-87874332 CCCACCTCCTTCAGTTCAAAGTA No data
Right 1011489316 6:87874345-87874367 TGGTGCTGTACTTTGGGGTATGG No data
1011489307_1011489313 5 Left 1011489307 6:87874310-87874332 CCCACCTCCTTCAGTTCAAAGTA No data
Right 1011489313 6:87874338-87874360 TAGGCTGTGGTGCTGTACTTTGG No data
1011489307_1011489315 7 Left 1011489307 6:87874310-87874332 CCCACCTCCTTCAGTTCAAAGTA No data
Right 1011489315 6:87874340-87874362 GGCTGTGGTGCTGTACTTTGGGG No data
1011489307_1011489312 -8 Left 1011489307 6:87874310-87874332 CCCACCTCCTTCAGTTCAAAGTA No data
Right 1011489312 6:87874325-87874347 TCAAAGTACTCAGTAGGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011489307 Original CRISPR TACTTTGAACTGAAGGAGGT GGG (reversed) Intergenic
No off target data available for this crispr