ID: 1011489456

View in Genome Browser
Species Human (GRCh38)
Location 6:87875421-87875443
Sequence CATTCTATGTGGGAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011489456_1011489462 -3 Left 1011489456 6:87875421-87875443 CCTTCCTCCTCCCACATAGAATG No data
Right 1011489462 6:87875441-87875463 ATGTGGTGACCACTGAGACTTGG No data
1011489456_1011489465 27 Left 1011489456 6:87875421-87875443 CCTTCCTCCTCCCACATAGAATG No data
Right 1011489465 6:87875471-87875493 TTCCCCAGAAAAGAATCCTCTGG No data
1011489456_1011489463 -2 Left 1011489456 6:87875421-87875443 CCTTCCTCCTCCCACATAGAATG No data
Right 1011489463 6:87875442-87875464 TGTGGTGACCACTGAGACTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011489456 Original CRISPR CATTCTATGTGGGAGGAGGA AGG (reversed) Intergenic
No off target data available for this crispr