ID: 1011489766

View in Genome Browser
Species Human (GRCh38)
Location 6:87878988-87879010
Sequence GGACAAAATTTTGATAGTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011489766_1011489771 22 Left 1011489766 6:87878988-87879010 CCATCACTATCAAAATTTTGTCC No data
Right 1011489771 6:87879033-87879055 CGGCTGCAATAAGTTGGAGCTGG No data
1011489766_1011489768 2 Left 1011489766 6:87878988-87879010 CCATCACTATCAAAATTTTGTCC No data
Right 1011489768 6:87879013-87879035 AATATTCCTGAGTATGAGATCGG No data
1011489766_1011489772 23 Left 1011489766 6:87878988-87879010 CCATCACTATCAAAATTTTGTCC No data
Right 1011489772 6:87879034-87879056 GGCTGCAATAAGTTGGAGCTGGG No data
1011489766_1011489770 16 Left 1011489766 6:87878988-87879010 CCATCACTATCAAAATTTTGTCC No data
Right 1011489770 6:87879027-87879049 TGAGATCGGCTGCAATAAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011489766 Original CRISPR GGACAAAATTTTGATAGTGA TGG (reversed) Intergenic
No off target data available for this crispr