ID: 1011489767

View in Genome Browser
Species Human (GRCh38)
Location 6:87879009-87879031
Sequence TCTCATACTCAGGAATATTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011489767_1011489773 10 Left 1011489767 6:87879009-87879031 CCTCAATATTCCTGAGTATGAGA No data
Right 1011489773 6:87879042-87879064 TAAGTTGGAGCTGGGTTGTCTGG No data
1011489767_1011489774 11 Left 1011489767 6:87879009-87879031 CCTCAATATTCCTGAGTATGAGA No data
Right 1011489774 6:87879043-87879065 AAGTTGGAGCTGGGTTGTCTGGG No data
1011489767_1011489770 -5 Left 1011489767 6:87879009-87879031 CCTCAATATTCCTGAGTATGAGA No data
Right 1011489770 6:87879027-87879049 TGAGATCGGCTGCAATAAGTTGG No data
1011489767_1011489772 2 Left 1011489767 6:87879009-87879031 CCTCAATATTCCTGAGTATGAGA No data
Right 1011489772 6:87879034-87879056 GGCTGCAATAAGTTGGAGCTGGG No data
1011489767_1011489771 1 Left 1011489767 6:87879009-87879031 CCTCAATATTCCTGAGTATGAGA No data
Right 1011489771 6:87879033-87879055 CGGCTGCAATAAGTTGGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011489767 Original CRISPR TCTCATACTCAGGAATATTG AGG (reversed) Intergenic
No off target data available for this crispr