ID: 1011489768

View in Genome Browser
Species Human (GRCh38)
Location 6:87879013-87879035
Sequence AATATTCCTGAGTATGAGAT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011489766_1011489768 2 Left 1011489766 6:87878988-87879010 CCATCACTATCAAAATTTTGTCC No data
Right 1011489768 6:87879013-87879035 AATATTCCTGAGTATGAGATCGG No data
1011489765_1011489768 5 Left 1011489765 6:87878985-87879007 CCACCATCACTATCAAAATTTTG No data
Right 1011489768 6:87879013-87879035 AATATTCCTGAGTATGAGATCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011489768 Original CRISPR AATATTCCTGAGTATGAGAT CGG Intergenic
No off target data available for this crispr