ID: 1011489769

View in Genome Browser
Species Human (GRCh38)
Location 6:87879019-87879041
Sequence TTGCAGCCGATCTCATACTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011489769_1011489775 21 Left 1011489769 6:87879019-87879041 CCTGAGTATGAGATCGGCTGCAA No data
Right 1011489775 6:87879063-87879085 GGGTGCTCATGTTCTCAAAATGG No data
1011489769_1011489771 -9 Left 1011489769 6:87879019-87879041 CCTGAGTATGAGATCGGCTGCAA No data
Right 1011489771 6:87879033-87879055 CGGCTGCAATAAGTTGGAGCTGG No data
1011489769_1011489773 0 Left 1011489769 6:87879019-87879041 CCTGAGTATGAGATCGGCTGCAA No data
Right 1011489773 6:87879042-87879064 TAAGTTGGAGCTGGGTTGTCTGG No data
1011489769_1011489772 -8 Left 1011489769 6:87879019-87879041 CCTGAGTATGAGATCGGCTGCAA No data
Right 1011489772 6:87879034-87879056 GGCTGCAATAAGTTGGAGCTGGG No data
1011489769_1011489774 1 Left 1011489769 6:87879019-87879041 CCTGAGTATGAGATCGGCTGCAA No data
Right 1011489774 6:87879043-87879065 AAGTTGGAGCTGGGTTGTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011489769 Original CRISPR TTGCAGCCGATCTCATACTC AGG (reversed) Intergenic
No off target data available for this crispr