ID: 1011489771

View in Genome Browser
Species Human (GRCh38)
Location 6:87879033-87879055
Sequence CGGCTGCAATAAGTTGGAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011489766_1011489771 22 Left 1011489766 6:87878988-87879010 CCATCACTATCAAAATTTTGTCC No data
Right 1011489771 6:87879033-87879055 CGGCTGCAATAAGTTGGAGCTGG No data
1011489765_1011489771 25 Left 1011489765 6:87878985-87879007 CCACCATCACTATCAAAATTTTG No data
Right 1011489771 6:87879033-87879055 CGGCTGCAATAAGTTGGAGCTGG No data
1011489767_1011489771 1 Left 1011489767 6:87879009-87879031 CCTCAATATTCCTGAGTATGAGA No data
Right 1011489771 6:87879033-87879055 CGGCTGCAATAAGTTGGAGCTGG No data
1011489769_1011489771 -9 Left 1011489769 6:87879019-87879041 CCTGAGTATGAGATCGGCTGCAA No data
Right 1011489771 6:87879033-87879055 CGGCTGCAATAAGTTGGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011489771 Original CRISPR CGGCTGCAATAAGTTGGAGC TGG Intergenic
No off target data available for this crispr