ID: 1011489772

View in Genome Browser
Species Human (GRCh38)
Location 6:87879034-87879056
Sequence GGCTGCAATAAGTTGGAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011489766_1011489772 23 Left 1011489766 6:87878988-87879010 CCATCACTATCAAAATTTTGTCC No data
Right 1011489772 6:87879034-87879056 GGCTGCAATAAGTTGGAGCTGGG No data
1011489769_1011489772 -8 Left 1011489769 6:87879019-87879041 CCTGAGTATGAGATCGGCTGCAA No data
Right 1011489772 6:87879034-87879056 GGCTGCAATAAGTTGGAGCTGGG No data
1011489765_1011489772 26 Left 1011489765 6:87878985-87879007 CCACCATCACTATCAAAATTTTG No data
Right 1011489772 6:87879034-87879056 GGCTGCAATAAGTTGGAGCTGGG No data
1011489767_1011489772 2 Left 1011489767 6:87879009-87879031 CCTCAATATTCCTGAGTATGAGA No data
Right 1011489772 6:87879034-87879056 GGCTGCAATAAGTTGGAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011489772 Original CRISPR GGCTGCAATAAGTTGGAGCT GGG Intergenic
No off target data available for this crispr