ID: 1011490582

View in Genome Browser
Species Human (GRCh38)
Location 6:87887149-87887171
Sequence AACCGCTTGGTAACCTCAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011490582_1011490586 28 Left 1011490582 6:87887149-87887171 CCTTCTGAGGTTACCAAGCGGTT No data
Right 1011490586 6:87887200-87887222 AAAGAAAAAGAACATGTTCTTGG No data
1011490582_1011490584 -8 Left 1011490582 6:87887149-87887171 CCTTCTGAGGTTACCAAGCGGTT No data
Right 1011490584 6:87887164-87887186 AAGCGGTTTTTAAAAAACCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011490582 Original CRISPR AACCGCTTGGTAACCTCAGA AGG (reversed) Intergenic
No off target data available for this crispr