ID: 1011492560

View in Genome Browser
Species Human (GRCh38)
Location 6:87907376-87907398
Sequence TCACTACTGCTCAAAGACTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011492560_1011492569 25 Left 1011492560 6:87907376-87907398 CCCAAGTCTTTGAGCAGTAGTGA No data
Right 1011492569 6:87907424-87907446 GGCTTGATCGGATGGTACTTTGG No data
1011492560_1011492565 0 Left 1011492560 6:87907376-87907398 CCCAAGTCTTTGAGCAGTAGTGA No data
Right 1011492565 6:87907399-87907421 AAGGAATCTCAGGAGAATATGGG No data
1011492560_1011492566 4 Left 1011492560 6:87907376-87907398 CCCAAGTCTTTGAGCAGTAGTGA No data
Right 1011492566 6:87907403-87907425 AATCTCAGGAGAATATGGGAAGG No data
1011492560_1011492564 -1 Left 1011492560 6:87907376-87907398 CCCAAGTCTTTGAGCAGTAGTGA No data
Right 1011492564 6:87907398-87907420 AAAGGAATCTCAGGAGAATATGG No data
1011492560_1011492568 17 Left 1011492560 6:87907376-87907398 CCCAAGTCTTTGAGCAGTAGTGA No data
Right 1011492568 6:87907416-87907438 TATGGGAAGGCTTGATCGGATGG No data
1011492560_1011492563 -10 Left 1011492560 6:87907376-87907398 CCCAAGTCTTTGAGCAGTAGTGA No data
Right 1011492563 6:87907389-87907411 GCAGTAGTGAAAGGAATCTCAGG No data
1011492560_1011492567 13 Left 1011492560 6:87907376-87907398 CCCAAGTCTTTGAGCAGTAGTGA No data
Right 1011492567 6:87907412-87907434 AGAATATGGGAAGGCTTGATCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011492560 Original CRISPR TCACTACTGCTCAAAGACTT GGG (reversed) Intergenic
No off target data available for this crispr