ID: 1011494865

View in Genome Browser
Species Human (GRCh38)
Location 6:87927644-87927666
Sequence GAAGTGTACTTCCAGTGGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011494865_1011494867 4 Left 1011494865 6:87927644-87927666 CCATTCCACTGGAAGTACACTTC No data
Right 1011494867 6:87927671-87927693 AAACCTCTGCAAAGCTTTCCTGG No data
1011494865_1011494871 27 Left 1011494865 6:87927644-87927666 CCATTCCACTGGAAGTACACTTC No data
Right 1011494871 6:87927694-87927716 TCCTGTAAGTTTACCTTCATGGG No data
1011494865_1011494870 26 Left 1011494865 6:87927644-87927666 CCATTCCACTGGAAGTACACTTC No data
Right 1011494870 6:87927693-87927715 GTCCTGTAAGTTTACCTTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011494865 Original CRISPR GAAGTGTACTTCCAGTGGAA TGG (reversed) Intergenic
No off target data available for this crispr