ID: 1011497459

View in Genome Browser
Species Human (GRCh38)
Location 6:87950549-87950571
Sequence CCACCATCAAGGTGATGTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011497459_1011497470 25 Left 1011497459 6:87950549-87950571 CCACCACATCACCTTGATGGTGG No data
Right 1011497470 6:87950597-87950619 CCTTCACTGTGTTCATTTCAGGG No data
1011497459_1011497471 26 Left 1011497459 6:87950549-87950571 CCACCACATCACCTTGATGGTGG No data
Right 1011497471 6:87950598-87950620 CTTCACTGTGTTCATTTCAGGGG No data
1011497459_1011497468 24 Left 1011497459 6:87950549-87950571 CCACCACATCACCTTGATGGTGG No data
Right 1011497468 6:87950596-87950618 CCCTTCACTGTGTTCATTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011497459 Original CRISPR CCACCATCAAGGTGATGTGG TGG (reversed) Intergenic
No off target data available for this crispr