ID: 1011497719

View in Genome Browser
Species Human (GRCh38)
Location 6:87952846-87952868
Sequence GGCACCAGTTGACCATTAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011497713_1011497719 25 Left 1011497713 6:87952798-87952820 CCGGCCAGCCCCTGTCAATTTTA No data
Right 1011497719 6:87952846-87952868 GGCACCAGTTGACCATTAGATGG No data
1011497715_1011497719 17 Left 1011497715 6:87952806-87952828 CCCCTGTCAATTTTAATTCTTGT No data
Right 1011497719 6:87952846-87952868 GGCACCAGTTGACCATTAGATGG No data
1011497714_1011497719 21 Left 1011497714 6:87952802-87952824 CCAGCCCCTGTCAATTTTAATTC No data
Right 1011497719 6:87952846-87952868 GGCACCAGTTGACCATTAGATGG No data
1011497717_1011497719 15 Left 1011497717 6:87952808-87952830 CCTGTCAATTTTAATTCTTGTAG No data
Right 1011497719 6:87952846-87952868 GGCACCAGTTGACCATTAGATGG No data
1011497716_1011497719 16 Left 1011497716 6:87952807-87952829 CCCTGTCAATTTTAATTCTTGTA No data
Right 1011497719 6:87952846-87952868 GGCACCAGTTGACCATTAGATGG No data
1011497712_1011497719 26 Left 1011497712 6:87952797-87952819 CCCGGCCAGCCCCTGTCAATTTT No data
Right 1011497719 6:87952846-87952868 GGCACCAGTTGACCATTAGATGG No data
1011497711_1011497719 29 Left 1011497711 6:87952794-87952816 CCGCCCGGCCAGCCCCTGTCAAT No data
Right 1011497719 6:87952846-87952868 GGCACCAGTTGACCATTAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011497719 Original CRISPR GGCACCAGTTGACCATTAGA TGG Intergenic
No off target data available for this crispr